Incidental Mutation 'R9239:Fbxo11'
ID 700655
Institutional Source Beutler Lab
Gene Symbol Fbxo11
Ensembl Gene ENSMUSG00000005371
Gene Name F-box protein 11
Synonyms GENA 104, Jf
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9239 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 88298287-88372719 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 88316522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 284 (H284N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005504]
AlphaFold Q7TPD1
Predicted Effect probably benign
Transcript: ENSMUST00000005504
AA Change: H360N

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371
AA Change: H360N

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371
AA Change: H284N

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135639
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cleft palate, facial clefting, and perinatal lethality. Mice homozygous for a knock-out allele show neonatal lethality, thick epidermis, decreased hair follicle number, absent keratohyalin granules, and increased epidermal Snail protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,646,608 (GRCm39) probably null Het
Aldh1l2 A G 10: 83,342,496 (GRCm39) F438S probably damaging Het
Alk T A 17: 72,256,864 (GRCm39) N665I probably benign Het
Anxa4 T A 6: 86,734,812 (GRCm39) T59S probably benign Het
B3gnt8 ACCCC ACCC 7: 25,327,676 (GRCm39) probably null Het
Cabs1 G A 5: 88,127,385 (GRCm39) R12Q probably benign Het
Cep152 A G 2: 125,425,830 (GRCm39) V845A probably benign Het
Dipk1a T C 5: 108,059,572 (GRCm39) E127G possibly damaging Het
Dsg1a T A 18: 20,473,750 (GRCm39) V941E probably damaging Het
Fubp1 A G 3: 151,923,486 (GRCm39) E98G probably damaging Het
Fyco1 A G 9: 123,626,637 (GRCm39) I1358T probably damaging Het
Ginm1 T C 10: 7,649,825 (GRCm39) N156S possibly damaging Het
Gm3739 T C 14: 18,505,221 (GRCm39) Y101C probably damaging Het
Ide T C 19: 37,307,898 (GRCm39) N38S Het
Itgb4 T C 11: 115,898,130 (GRCm39) V1644A probably damaging Het
Itpka A G 2: 119,580,023 (GRCm39) D254G probably damaging Het
Kat7 T A 11: 95,197,020 (GRCm39) R6S probably benign Het
Klhl40 A T 9: 121,607,637 (GRCm39) T266S probably benign Het
Lratd1 A G 12: 14,200,185 (GRCm39) W181R probably damaging Het
Mmaa T C 8: 79,995,856 (GRCm39) D289G probably damaging Het
Muc5ac A T 7: 141,353,954 (GRCm39) D851V probably damaging Het
Or1e29 A G 11: 73,667,346 (GRCm39) V269A probably benign Het
Or52n4 G T 7: 104,293,746 (GRCm39) H278N probably damaging Het
Or6b3 T C 1: 92,439,454 (GRCm39) T99A probably benign Het
Pcdh17 T G 14: 84,770,649 (GRCm39) I1042M probably benign Het
Pipox A G 11: 77,774,765 (GRCm39) I106T probably benign Het
Ppcs C T 4: 119,276,235 (GRCm39) V290M possibly damaging Het
Rnasel T A 1: 153,630,097 (GRCm39) N204K probably damaging Het
Runx1 A G 16: 92,402,935 (GRCm39) Y336H probably damaging Het
Sell A G 1: 163,893,176 (GRCm39) I131V possibly damaging Het
Serpina3f A G 12: 104,184,710 (GRCm39) R285G possibly damaging Het
Slc25a2 A T 18: 37,771,169 (GRCm39) M120K possibly damaging Het
Slc47a1 A T 11: 61,250,344 (GRCm39) probably null Het
Slc4a11 C T 2: 130,533,664 (GRCm39) A100T probably damaging Het
Spats2l A G 1: 57,871,257 (GRCm39) probably benign Het
Spopfm1 T A 3: 94,173,871 (GRCm39) V289E probably benign Het
Taf1b T A 12: 24,606,015 (GRCm39) L431H probably damaging Het
Tectb CT C 19: 55,181,094 (GRCm39) probably null Het
Thsd7b G A 1: 130,087,453 (GRCm39) probably null Het
Tmtc4 A G 14: 123,165,078 (GRCm39) Y594H possibly damaging Het
Trim33 T C 3: 103,237,453 (GRCm39) F599L probably benign Het
Vcl A G 14: 21,072,092 (GRCm39) D819G probably damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn2r1 G T 3: 64,011,959 (GRCm39) V607L probably damaging Het
Other mutations in Fbxo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Fbxo11 APN 17 88,310,324 (GRCm39) missense probably benign 0.02
IGL01908:Fbxo11 APN 17 88,299,728 (GRCm39) missense probably benign 0.10
IGL02012:Fbxo11 APN 17 88,320,079 (GRCm39) missense probably benign 0.00
IGL02149:Fbxo11 APN 17 88,301,187 (GRCm39) missense possibly damaging 0.85
IGL02223:Fbxo11 APN 17 88,316,714 (GRCm39) missense probably benign 0.03
IGL02586:Fbxo11 APN 17 88,318,711 (GRCm39) unclassified probably benign
IGL03265:Fbxo11 APN 17 88,300,259 (GRCm39) missense probably damaging 1.00
Gravlachs UTSW 17 88,304,957 (GRCm39) missense
R0184:Fbxo11 UTSW 17 88,316,101 (GRCm39) missense probably benign 0.19
R0335:Fbxo11 UTSW 17 88,323,041 (GRCm39) missense possibly damaging 0.90
R0918:Fbxo11 UTSW 17 88,305,031 (GRCm39) missense probably damaging 1.00
R1658:Fbxo11 UTSW 17 88,320,086 (GRCm39) missense probably benign 0.01
R3725:Fbxo11 UTSW 17 88,316,714 (GRCm39) missense probably benign 0.03
R4194:Fbxo11 UTSW 17 88,316,536 (GRCm39) missense possibly damaging 0.94
R4884:Fbxo11 UTSW 17 88,299,761 (GRCm39) missense probably damaging 0.99
R4902:Fbxo11 UTSW 17 88,372,702 (GRCm39) unclassified probably benign
R5651:Fbxo11 UTSW 17 88,323,136 (GRCm39) missense probably benign 0.01
R6137:Fbxo11 UTSW 17 88,316,097 (GRCm39) missense probably benign 0.00
R6217:Fbxo11 UTSW 17 88,316,332 (GRCm39) missense probably benign 0.00
R6482:Fbxo11 UTSW 17 88,320,086 (GRCm39) missense probably benign 0.01
R7383:Fbxo11 UTSW 17 88,310,282 (GRCm39) missense
R7813:Fbxo11 UTSW 17 88,308,245 (GRCm39) missense
R7823:Fbxo11 UTSW 17 88,300,610 (GRCm39) missense probably damaging 0.98
R7914:Fbxo11 UTSW 17 88,320,031 (GRCm39) missense
R8835:Fbxo11 UTSW 17 88,321,874 (GRCm39) missense
R8882:Fbxo11 UTSW 17 88,304,957 (GRCm39) missense
R8883:Fbxo11 UTSW 17 88,305,044 (GRCm39) missense
R9056:Fbxo11 UTSW 17 88,310,249 (GRCm39) missense
R9223:Fbxo11 UTSW 17 88,323,124 (GRCm39) missense
R9574:Fbxo11 UTSW 17 88,321,951 (GRCm39) missense
R9616:Fbxo11 UTSW 17 88,316,098 (GRCm39) missense
R9639:Fbxo11 UTSW 17 88,316,107 (GRCm39) missense
R9687:Fbxo11 UTSW 17 88,316,494 (GRCm39) missense
RF002:Fbxo11 UTSW 17 88,303,481 (GRCm39) missense
X0060:Fbxo11 UTSW 17 88,299,734 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACAATGCTTGATAGTGGGAC -3'
(R):5'- TTCGACCTTCGTGTTCATGG -3'

Sequencing Primer
(F):5'- TGGCCACTGACACACACTG -3'
(R):5'- TTCATGGAAGGCTCTGAAGATGC -3'
Posted On 2022-02-07