Incidental Mutation 'R0761:Cul3'
ID70067
Institutional Source Beutler Lab
Gene Symbol Cul3
Ensembl Gene ENSMUSG00000004364
Gene Namecullin 3
Synonyms
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location80264923-80340480 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 80277486 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000163119] [ENSMUST00000164108]
Predicted Effect probably benign
Transcript: ENSMUST00000163119
SMART Domains Protein: ENSMUSP00000130738
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
PDB:4AP2|B 1 389 N/A PDB
SCOP:d1ldja2 30 382 1e-117 SMART
Blast:CULLIN 258 295 2e-15 BLAST
CULLIN 413 563 1.98e-90 SMART
Cullin_Nedd8 695 762 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164108
SMART Domains Protein: ENSMUSP00000131891
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
SCOP:d1ldja2 23 316 1e-101 SMART
PDB:4APF|B 23 323 N/A PDB
Blast:CULLIN 192 229 1e-15 BLAST
CULLIN 347 497 1.98e-90 SMART
Cullin_Nedd8 629 696 1.49e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167794
Predicted Effect probably benign
Transcript: ENSMUST00000168372
SMART Domains Protein: ENSMUSP00000132485
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
Cullin_Nedd8 38 105 3.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192839
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a targeted null mutation accumulate cyclin E, exhibit abnormal cycling in cells of extraembryonic ectoderm and trophectoderm, reduced size, abnormal gastrulation and trophoblast cells, absence of an amnion, and death by embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Cul3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Cul3 APN 1 80288740 splice site probably benign
IGL01454:Cul3 APN 1 80304183 missense probably damaging 0.97
IGL01510:Cul3 APN 1 80282679 missense probably damaging 1.00
IGL01701:Cul3 APN 1 80277423 missense probably damaging 0.97
IGL02117:Cul3 APN 1 80323064 splice site probably benign
IGL02194:Cul3 APN 1 80323037 missense probably benign 0.03
IGL02217:Cul3 APN 1 80283767 missense probably damaging 0.97
IGL02417:Cul3 APN 1 80322902 missense probably damaging 1.00
IGL02445:Cul3 APN 1 80304169 missense possibly damaging 0.74
IGL02601:Cul3 APN 1 80271715 intron probably benign
IGL03201:Cul3 APN 1 80281427 missense probably damaging 1.00
R0467:Cul3 UTSW 1 80280863 missense probably benign 0.01
R0662:Cul3 UTSW 1 80271565 missense probably damaging 1.00
R0688:Cul3 UTSW 1 80271564 missense possibly damaging 0.63
R0924:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0930:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0940:Cul3 UTSW 1 80322847 intron probably benign
R1117:Cul3 UTSW 1 80280924 missense probably damaging 1.00
R1572:Cul3 UTSW 1 80282789 missense possibly damaging 0.91
R2384:Cul3 UTSW 1 80283689 missense probably damaging 0.99
R3894:Cul3 UTSW 1 80283690 missense probably damaging 0.97
R4676:Cul3 UTSW 1 80271674 missense probably damaging 1.00
R4893:Cul3 UTSW 1 80288850 missense probably damaging 0.98
R4908:Cul3 UTSW 1 80280915 missense possibly damaging 0.91
R4910:Cul3 UTSW 1 80290089 missense probably benign 0.09
R5173:Cul3 UTSW 1 80281416 missense possibly damaging 0.94
R5787:Cul3 UTSW 1 80282721 missense probably benign 0.13
R5887:Cul3 UTSW 1 80276422 missense possibly damaging 0.94
R6057:Cul3 UTSW 1 80271532 missense probably damaging 1.00
R6066:Cul3 UTSW 1 80283759 missense probably benign 0.06
R6279:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6300:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6617:Cul3 UTSW 1 80276439 missense probably damaging 1.00
R7059:Cul3 UTSW 1 80276424 missense probably benign 0.00
R7223:Cul3 UTSW 1 80287000 missense probably benign 0.14
R7774:Cul3 UTSW 1 80269294 missense probably benign
R7958:Cul3 UTSW 1 80271557 missense probably benign 0.11
Z1088:Cul3 UTSW 1 80290091 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCAATGGGGTGTCTGGCTTAATC -3'
(R):5'- AAGAGTGCCAGTGCCCTCTTTTC -3'

Sequencing Primer
(F):5'- GGTGTCTGGCTTAATCTTAGAAATAC -3'
(R):5'- TCACTGCCATAGGATAGGCTG -3'
Posted On2013-09-30