Mutagenetix > Incidental Mutation

Incidental Mutation 'R9240:Polr1a'

700683

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9240 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 71963677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 998 (C998*)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

AlphaFold

O35134

Predicted Effect

probably null
Transcript: ENSMUST00000055296
AA Change: C998*

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: C998*

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000205517
AA Change: C23*

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	A	G	5: 107,452,168	D175G	probably benign	Het
Acsl1	A	G	8: 46,513,369	I187V	probably benign	Het
Adam7	C	A	14: 68,509,759	V584L	probably benign	Het
Arsg	T	A	11: 109,572,267	V451E	probably benign	Het
Cacnb3	C	T	15: 98,642,605	P338L	probably benign	Het
Cars	G	T	7: 143,584,796	P218Q	probably benign	Het
Ccdc180	T	C	4: 45,917,566		probably null	Het
Cdh23	C	T	10: 60,379,265	D1431N	probably benign	Het
Cenpf	A	T	1: 189,656,970	V1555D	probably benign	Het
Creb3l2	T	C	6: 37,334,571	N428D	possibly damaging	Het
Crebbp	A	T	16: 4,099,673		probably null	Het
Cstf1	C	A	2: 172,375,749	P94Q	probably damaging	Het
Dis3l	A	G	9: 64,310,165		probably null	Het
Dlc1	A	T	8: 36,584,851	D124E	probably benign	Het
Dpysl3	C	T	18: 43,354,802	V159I	probably benign	Het
Eea1	T	G	10: 95,940,962	I5S	probably benign	Het
F7	A	T	8: 13,035,173	T400S	probably damaging	Het
Fbxo38	C	A	18: 62,518,561	E558*	probably null	Het
Fcgr2b	C	T	1: 170,969,473		probably null	Het
Fktn	G	A	4: 53,734,854	G125D	probably benign	Het
Flt1	T	C	5: 147,681,866	N220D	probably benign	Het
Fzd9	A	G	5: 135,249,958	Y358H	probably damaging	Het
Gcc2	C	T	10: 58,270,576	Q545*	probably null	Het
Gkn3	T	C	6: 87,388,807	N10S	probably benign	Het
Gls	C	G	1: 52,168,394	V604L	probably benign	Het
Gtf2i	T	A	5: 134,263,765	Q375L	probably benign	Het
Hells	A	G	19: 38,946,845	M320V	possibly damaging	Het
Ints3	T	C	3: 90,403,103	S497G	possibly damaging	Het
Iqub	C	A	6: 24,505,623	L95F	probably benign	Het
Mat1a	G	A	14: 41,105,616	C9Y	probably benign	Het
Mfsd4b5	A	G	10: 39,975,103	L103P	probably damaging	Het
Ms4a14	T	C	19: 11,304,500	I231M	possibly damaging	Het
Muc16	T	C	9: 18,538,013	T7580A	unknown	Het
Myb	A	T	10: 21,140,601	L670Q	probably damaging	Het
Nisch	A	G	14: 31,185,031	L236P	unknown	Het
Olfr1166	A	C	2: 88,124,887	F33V	probably benign	Het
Plscr4	A	T	9: 92,484,881	M183L	probably benign	Het
Prokr2	A	T	2: 132,381,457	V55E	possibly damaging	Het
Prr12	A	T	7: 45,034,651	V1655E	probably damaging	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,912		probably benign	Het
Rspo1	C	T	4: 124,991,339	L3F	probably benign	Het
Rtn4rl1	C	A	11: 75,265,256	D171E	probably damaging	Het
Ryr1	A	G	7: 29,043,888	F3895L	probably damaging	Het
Scn8a	G	T	15: 101,017,187	G1211*	probably null	Het
Slc4a11	C	T	2: 130,691,744	A100T	probably damaging	Het
Smarcd3	T	A	5: 24,596,833	M103L	probably benign	Het
Smg1	A	T	7: 118,139,808	S3458T	probably benign	Het
Smg6	C	T	11: 74,935,058	R738W	probably damaging	Het
Spef2	G	A	15: 9,578,315	Q1708*	probably null	Het
Taf2	A	T	15: 55,063,068	V162E	probably null	Het
Tbc1d23	A	T	16: 57,212,385	N154K	possibly damaging	Het
Tbx3	A	G	5: 119,680,895	S532G	probably benign	Het
Tedc1	T	C	12: 113,157,690	I177T	probably benign	Het
Tnrc6b	G	C	15: 80,880,061	G588A	probably damaging	Het
Top2a	T	A	11: 99,010,542	K519*	probably null	Het
Trim47	T	A	11: 116,108,322	M243L	probably benign	Het
Ttn	A	T	2: 76,811,521		probably null	Het
Uggt1	T	C	1: 36,182,615	E624G	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn2r9	A	G	5: 108,848,233	V183A	possibly damaging	Het
Zfp212	T	A	6: 47,929,098	V197E	probably benign	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGCTAAATAGGAAACCTGGCC -3'
(R):5'- ACATTACCTCATAATTGCCGGC -3'

Sequencing Primer
(F):5'- GAGGTGCTCTCTTCCTGGAAAAC -3'
(R):5'- CTCATAATTGCCGGCCAGAAAGG -3'

Posted On

2022-02-07