Incidental Mutation 'R9240:Polr1a'
ID 700683
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Name polymerase (RNA) I polypeptide A
Synonyms RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9240 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71909053-71984935 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 71963677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 998 (C998*)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296]
AlphaFold O35134
Predicted Effect probably null
Transcript: ENSMUST00000055296
AA Change: C998*
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: C998*

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205517
AA Change: C23*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,452,168 D175G probably benign Het
Acsl1 A G 8: 46,513,369 I187V probably benign Het
Adam7 C A 14: 68,509,759 V584L probably benign Het
Arsg T A 11: 109,572,267 V451E probably benign Het
Cacnb3 C T 15: 98,642,605 P338L probably benign Het
Cars G T 7: 143,584,796 P218Q probably benign Het
Ccdc180 T C 4: 45,917,566 probably null Het
Cdh23 C T 10: 60,379,265 D1431N probably benign Het
Cenpf A T 1: 189,656,970 V1555D probably benign Het
Creb3l2 T C 6: 37,334,571 N428D possibly damaging Het
Crebbp A T 16: 4,099,673 probably null Het
Cstf1 C A 2: 172,375,749 P94Q probably damaging Het
Dis3l A G 9: 64,310,165 probably null Het
Dlc1 A T 8: 36,584,851 D124E probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Eea1 T G 10: 95,940,962 I5S probably benign Het
F7 A T 8: 13,035,173 T400S probably damaging Het
Fbxo38 C A 18: 62,518,561 E558* probably null Het
Fcgr2b C T 1: 170,969,473 probably null Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Flt1 T C 5: 147,681,866 N220D probably benign Het
Fzd9 A G 5: 135,249,958 Y358H probably damaging Het
Gcc2 C T 10: 58,270,576 Q545* probably null Het
Gkn3 T C 6: 87,388,807 N10S probably benign Het
Gls C G 1: 52,168,394 V604L probably benign Het
Gtf2i T A 5: 134,263,765 Q375L probably benign Het
Hells A G 19: 38,946,845 M320V possibly damaging Het
Ints3 T C 3: 90,403,103 S497G possibly damaging Het
Iqub C A 6: 24,505,623 L95F probably benign Het
Mat1a G A 14: 41,105,616 C9Y probably benign Het
Mfsd4b5 A G 10: 39,975,103 L103P probably damaging Het
Ms4a14 T C 19: 11,304,500 I231M possibly damaging Het
Muc16 T C 9: 18,538,013 T7580A unknown Het
Myb A T 10: 21,140,601 L670Q probably damaging Het
Nisch A G 14: 31,185,031 L236P unknown Het
Olfr1166 A C 2: 88,124,887 F33V probably benign Het
Plscr4 A T 9: 92,484,881 M183L probably benign Het
Prokr2 A T 2: 132,381,457 V55E possibly damaging Het
Prr12 A T 7: 45,034,651 V1655E probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Rspo1 C T 4: 124,991,339 L3F probably benign Het
Rtn4rl1 C A 11: 75,265,256 D171E probably damaging Het
Ryr1 A G 7: 29,043,888 F3895L probably damaging Het
Scn8a G T 15: 101,017,187 G1211* probably null Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Smarcd3 T A 5: 24,596,833 M103L probably benign Het
Smg1 A T 7: 118,139,808 S3458T probably benign Het
Smg6 C T 11: 74,935,058 R738W probably damaging Het
Spef2 G A 15: 9,578,315 Q1708* probably null Het
Taf2 A T 15: 55,063,068 V162E probably null Het
Tbc1d23 A T 16: 57,212,385 N154K possibly damaging Het
Tbx3 A G 5: 119,680,895 S532G probably benign Het
Tedc1 T C 12: 113,157,690 I177T probably benign Het
Tnrc6b G C 15: 80,880,061 G588A probably damaging Het
Top2a T A 11: 99,010,542 K519* probably null Het
Trim47 T A 11: 116,108,322 M243L probably benign Het
Ttn A T 2: 76,811,521 probably null Het
Uggt1 T C 1: 36,182,615 E624G possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r9 A G 5: 108,848,233 V183A possibly damaging Het
Zfp212 T A 6: 47,929,098 V197E probably benign Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
R9055:Polr1a UTSW 6 71915069 missense possibly damaging 0.46
R9088:Polr1a UTSW 6 71931783 missense probably benign 0.26
R9211:Polr1a UTSW 6 71966537 missense probably damaging 1.00
R9228:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R9267:Polr1a UTSW 6 71965558 missense probably benign
R9302:Polr1a UTSW 6 71924699 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTAAATAGGAAACCTGGCC -3'
(R):5'- ACATTACCTCATAATTGCCGGC -3'

Sequencing Primer
(F):5'- GAGGTGCTCTCTTCCTGGAAAAC -3'
(R):5'- CTCATAATTGCCGGCCAGAAAGG -3'
Posted On 2022-02-07