Incidental Mutation 'R9240:Tnrc6b'
ID 700713
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R9240 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 80880061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 588 (G588A)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: G588A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: G588A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,452,168 D175G probably benign Het
Acsl1 A G 8: 46,513,369 I187V probably benign Het
Adam7 C A 14: 68,509,759 V584L probably benign Het
Arsg T A 11: 109,572,267 V451E probably benign Het
Cacnb3 C T 15: 98,642,605 P338L probably benign Het
Cars G T 7: 143,584,796 P218Q probably benign Het
Ccdc180 T C 4: 45,917,566 probably null Het
Cdh23 C T 10: 60,379,265 D1431N probably benign Het
Cenpf A T 1: 189,656,970 V1555D probably benign Het
Creb3l2 T C 6: 37,334,571 N428D possibly damaging Het
Crebbp A T 16: 4,099,673 probably null Het
Cstf1 C A 2: 172,375,749 P94Q probably damaging Het
Dis3l A G 9: 64,310,165 probably null Het
Dlc1 A T 8: 36,584,851 D124E probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Eea1 T G 10: 95,940,962 I5S probably benign Het
F7 A T 8: 13,035,173 T400S probably damaging Het
Fbxo38 C A 18: 62,518,561 E558* probably null Het
Fcgr2b C T 1: 170,969,473 probably null Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Flt1 T C 5: 147,681,866 N220D probably benign Het
Fzd9 A G 5: 135,249,958 Y358H probably damaging Het
Gcc2 C T 10: 58,270,576 Q545* probably null Het
Gkn3 T C 6: 87,388,807 N10S probably benign Het
Gls C G 1: 52,168,394 V604L probably benign Het
Gtf2i T A 5: 134,263,765 Q375L probably benign Het
Hells A G 19: 38,946,845 M320V possibly damaging Het
Ints3 T C 3: 90,403,103 S497G possibly damaging Het
Iqub C A 6: 24,505,623 L95F probably benign Het
Mat1a G A 14: 41,105,616 C9Y probably benign Het
Mfsd4b5 A G 10: 39,975,103 L103P probably damaging Het
Ms4a14 T C 19: 11,304,500 I231M possibly damaging Het
Muc16 T C 9: 18,538,013 T7580A unknown Het
Myb A T 10: 21,140,601 L670Q probably damaging Het
Nisch A G 14: 31,185,031 L236P unknown Het
Olfr1166 A C 2: 88,124,887 F33V probably benign Het
Plscr4 A T 9: 92,484,881 M183L probably benign Het
Polr1a T A 6: 71,963,677 C998* probably null Het
Prokr2 A T 2: 132,381,457 V55E possibly damaging Het
Prr12 A T 7: 45,034,651 V1655E probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Rspo1 C T 4: 124,991,339 L3F probably benign Het
Rtn4rl1 C A 11: 75,265,256 D171E probably damaging Het
Ryr1 A G 7: 29,043,888 F3895L probably damaging Het
Scn8a G T 15: 101,017,187 G1211* probably null Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Smarcd3 T A 5: 24,596,833 M103L probably benign Het
Smg1 A T 7: 118,139,808 S3458T probably benign Het
Smg6 C T 11: 74,935,058 R738W probably damaging Het
Spef2 G A 15: 9,578,315 Q1708* probably null Het
Taf2 A T 15: 55,063,068 V162E probably null Het
Tbc1d23 A T 16: 57,212,385 N154K possibly damaging Het
Tbx3 A G 5: 119,680,895 S532G probably benign Het
Tedc1 T C 12: 113,157,690 I177T probably benign Het
Top2a T A 11: 99,010,542 K519* probably null Het
Trim47 T A 11: 116,108,322 M243L probably benign Het
Ttn A T 2: 76,811,521 probably null Het
Uggt1 T C 1: 36,182,615 E624G possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r9 A G 5: 108,848,233 V183A possibly damaging Het
Zfp212 T A 6: 47,929,098 V197E probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
R8872:Tnrc6b UTSW 15 80918089 missense probably benign 0.23
R9029:Tnrc6b UTSW 15 80878978 missense possibly damaging 0.83
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGCCCTCAGGACAATAATGAC -3'
(R):5'- AGTGTTTGAGAGCACCCTAGG -3'

Sequencing Primer
(F):5'- CTCAGGACAATAATGACAACAAATGG -3'
(R):5'- TCAGTCCGGCTCAAAAGAGTCTG -3'
Posted On 2022-02-07