Incidental Mutation 'R0761:Olfr1248'
ID70073
Institutional Source Beutler Lab
Gene Symbol Olfr1248
Ensembl Gene ENSMUSG00000111239
Gene Nameolfactory receptor 1248
SynonymsMOR231-10, GA_x6K02T2Q125-51059648-51058725
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89617168-89618245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89617835 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 119 (D119G)
Ref Sequence ENSEMBL: ENSMUSP00000150117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111532] [ENSMUST00000186710] [ENSMUST00000216129] [ENSMUST00000216424]
Predicted Effect probably damaging
Transcript: ENSMUST00000099770
AA Change: D119G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097358
Gene: ENSMUSG00000075080
AA Change: D119G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111532
SMART Domains Protein: ENSMUSP00000107157
Gene: ENSMUSG00000075081

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.2e-48 PFAM
Pfam:7tm_1 39 285 1.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186710
AA Change: D119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140045
Gene: ENSMUSG00000110819
AA Change: D119G

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.1e-28 PFAM
Pfam:7tm_4 137 278 1e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216129
AA Change: D119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216424
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Olfr1248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02871:Olfr1248 APN 2 89618160 missense probably benign 0.00
PIT4431001:Olfr1248 UTSW 2 89617857 missense probably benign 0.00
R0504:Olfr1248 UTSW 2 89618094 missense probably damaging 1.00
R2176:Olfr1248 UTSW 2 89617580 missense possibly damaging 0.54
R3722:Olfr1248 UTSW 2 89618159 missense possibly damaging 0.88
R4030:Olfr1248 UTSW 2 89617863 missense probably damaging 0.99
R4440:Olfr1248 UTSW 2 89618168 missense probably damaging 1.00
R4756:Olfr1248 UTSW 2 89617470 missense possibly damaging 0.86
R4981:Olfr1248 UTSW 2 89617425 missense probably damaging 1.00
R5678:Olfr1248 UTSW 2 89617281 missense probably benign
R6503:Olfr1248 UTSW 2 89617578 missense possibly damaging 0.76
R6569:Olfr1248 UTSW 2 89618015 missense possibly damaging 0.83
R6770:Olfr1248 UTSW 2 89617862 missense probably benign 0.39
R7823:Olfr1248 UTSW 2 89617269 makesense probably null
R8423:Olfr1248 UTSW 2 89617987 missense probably damaging 1.00
R8438:Olfr1248 UTSW 2 89617710 missense possibly damaging 0.60
RF008:Olfr1248 UTSW 2 89617367 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAGCAAAATGGTCAATGACATTGGGTC -3'
(R):5'- CAGATGGTTACTGAGCAATCGCTGAG -3'

Sequencing Primer
(F):5'- GGTCCACAAAAAGGAAGTAAATACAC -3'
(R):5'- CATGTCAAGCACTGATCTTCTGAG -3'
Posted On2013-09-30