Incidental Mutation 'R0761:Kcna4'
ID70075
Institutional Source Beutler Lab
Gene Symbol Kcna4
Ensembl Gene ENSMUSG00000042604
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 4
SynonymsKv1.4
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location107290639-107298502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107296072 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 384 (S384T)
Ref Sequence ENSEMBL: ENSMUSP00000037958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037012]
Predicted Effect probably benign
Transcript: ENSMUST00000037012
AA Change: S384T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037958
Gene: ENSMUSG00000042604
AA Change: S384T

DomainStartEndE-ValueType
Pfam:K_channel_TID 1 74 1.5e-42 PFAM
low complexity region 77 89 N/A INTRINSIC
coiled coil region 112 139 N/A INTRINSIC
low complexity region 160 166 N/A INTRINSIC
BTB 177 277 1.67e-8 SMART
Pfam:Ion_trans 307 572 2.8e-51 PFAM
Pfam:Ion_trans_2 480 565 9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173191
Meta Mutation Damage Score 0.1022 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal; however, a small subset of mutants exhibit spontaneous seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Kcna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kcna4 APN 2 107295862 missense probably damaging 1.00
IGL01025:Kcna4 APN 2 107296391 missense probably damaging 0.99
IGL01433:Kcna4 APN 2 107296733 missense probably damaging 0.99
IGL01805:Kcna4 APN 2 107296498 missense probably damaging 1.00
IGL02121:Kcna4 APN 2 107296618 missense possibly damaging 0.92
Pinched UTSW 2 107296549 missense probably damaging 1.00
R6381_Kcna4_300 UTSW 2 107294972 missense probably benign 0.05
PIT4377001:Kcna4 UTSW 2 107296860 missense possibly damaging 0.83
R0255:Kcna4 UTSW 2 107296562 missense probably damaging 1.00
R0650:Kcna4 UTSW 2 107295582 nonsense probably null
R1211:Kcna4 UTSW 2 107295315 small deletion probably benign
R1553:Kcna4 UTSW 2 107296687 missense probably benign 0.02
R1854:Kcna4 UTSW 2 107296484 missense probably damaging 1.00
R1915:Kcna4 UTSW 2 107296778 missense probably benign 0.01
R1974:Kcna4 UTSW 2 107296220 missense possibly damaging 0.65
R4002:Kcna4 UTSW 2 107295914 missense probably damaging 1.00
R4163:Kcna4 UTSW 2 107295806 missense probably damaging 1.00
R4413:Kcna4 UTSW 2 107295373 missense probably benign 0.01
R4474:Kcna4 UTSW 2 107296007 missense probably benign
R4492:Kcna4 UTSW 2 107296091 missense probably damaging 1.00
R4525:Kcna4 UTSW 2 107295065 missense possibly damaging 0.93
R4766:Kcna4 UTSW 2 107296543 missense probably damaging 1.00
R4787:Kcna4 UTSW 2 107296468 missense probably damaging 1.00
R5423:Kcna4 UTSW 2 107295806 nonsense probably null
R5725:Kcna4 UTSW 2 107296876 missense possibly damaging 0.48
R6381:Kcna4 UTSW 2 107294972 missense probably benign 0.05
R6399:Kcna4 UTSW 2 107296549 missense probably damaging 1.00
R6787:Kcna4 UTSW 2 107295325 missense possibly damaging 0.91
R6891:Kcna4 UTSW 2 107296307 missense probably damaging 1.00
R7057:Kcna4 UTSW 2 107295320 missense probably damaging 0.96
R7250:Kcna4 UTSW 2 107296318 missense possibly damaging 0.92
R7522:Kcna4 UTSW 2 107296255 missense probably damaging 1.00
R7799:Kcna4 UTSW 2 107295892 missense possibly damaging 0.70
R8758:Kcna4 UTSW 2 107296149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATTTTGCCTGGAAACCTTGCCG -3'
(R):5'- CGCATCTGGAATGCTTTGGAAATGG -3'

Sequencing Primer
(F):5'- AAACCTTGCCGGAGTTCAG -3'
(R):5'- GATAAGAAGGCCCAGTTCCCG -3'
Posted On2013-09-30