Incidental Mutation 'R0761:Polr3f'
ID70076
Institutional Source Beutler Lab
Gene Symbol Polr3f
Ensembl Gene ENSMUSG00000027427
Gene Namepolymerase (RNA) III (DNA directed) polypeptide F
Synonyms3110032A07Rik, 3010019O03Rik, RPC6, RPC39, 2810411G20Rik
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location144527718-144541995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144534407 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 142 (V142E)
Ref Sequence ENSEMBL: ENSMUSP00000028914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028914] [ENSMUST00000110017]
PDB Structure Solution structure of rpc34 subunit in RNA polymerase III from mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028914
AA Change: V142E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028914
Gene: ENSMUSG00000027427
AA Change: V142E

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc34 1 315 6.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110017
SMART Domains Protein: ENSMUSP00000105644
Gene: ENSMUSG00000027427

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc34 1 105 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155567
Meta Mutation Damage Score 0.7906 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Polr3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Polr3f UTSW 2 144536275 unclassified probably benign
R1307:Polr3f UTSW 2 144533193 missense probably damaging 1.00
R1340:Polr3f UTSW 2 144538628 missense probably benign 0.01
R1992:Polr3f UTSW 2 144536310 missense probably benign 0.00
R4817:Polr3f UTSW 2 144534081 makesense probably null
R6037:Polr3f UTSW 2 144536023 missense probably damaging 0.98
R6037:Polr3f UTSW 2 144536023 missense probably damaging 0.98
R6291:Polr3f UTSW 2 144534388 missense probably damaging 1.00
R8214:Polr3f UTSW 2 144536310 missense probably benign 0.00
R8546:Polr3f UTSW 2 144532364 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACACCAAGATTCCAGGAAATGTTCAG -3'
(R):5'- AGTCCAGTATGCAGCAAGTTAAAGTCAG -3'

Sequencing Primer
(F):5'- CCAGGAAATGTTCAGTTAGAATGAC -3'
(R):5'- GCACAACAGGGGCTACATTTTTAG -3'
Posted On2013-09-30