Incidental Mutation 'R0761:L3mbtl1'
ID70077
Institutional Source Beutler Lab
Gene Symbol L3mbtl1
Ensembl Gene ENSMUSG00000035576
Gene NameL3MBTL1 histone methyl-lysine binding protein
SynonymsL3MBTL1
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location162943472-162974522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 162966047 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 534 (R534H)
Ref Sequence ENSEMBL: ENSMUSP00000044038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035751]
Predicted Effect probably damaging
Transcript: ENSMUST00000035751
AA Change: R534H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: R534H

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
MBT 280 380 5.34e-53 SMART
MBT 388 487 2.17e-53 SMART
MBT 496 591 1.49e-51 SMART
Pfam:zf-C2HC 627 655 1.7e-17 PFAM
SAM 754 821 3.49e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153416
Meta Mutation Damage Score 0.1958 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in L3mbtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:L3mbtl1 APN 2 162967063 missense probably damaging 1.00
IGL01090:L3mbtl1 APN 2 162966005 missense probably damaging 1.00
IGL01291:L3mbtl1 APN 2 162970180 missense probably benign 0.30
IGL02897:L3mbtl1 APN 2 162965772 missense probably damaging 1.00
IGL02974:L3mbtl1 APN 2 162970183 missense possibly damaging 0.68
IGL02986:L3mbtl1 APN 2 162970305 missense probably damaging 1.00
IGL03057:L3mbtl1 APN 2 162967383 missense probably damaging 1.00
IGL03372:L3mbtl1 APN 2 162971157 splice site probably benign
ANU05:L3mbtl1 UTSW 2 162970180 missense probably benign 0.30
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0078:L3mbtl1 UTSW 2 162947226 missense probably benign 0.12
R0505:L3mbtl1 UTSW 2 162947335 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971163 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971164 critical splice acceptor site probably null
R1789:L3mbtl1 UTSW 2 162974502 missense probably benign
R1970:L3mbtl1 UTSW 2 162959572 missense probably damaging 1.00
R2114:L3mbtl1 UTSW 2 162960070 splice site probably null
R2115:L3mbtl1 UTSW 2 162960070 splice site probably null
R2116:L3mbtl1 UTSW 2 162960070 splice site probably null
R2117:L3mbtl1 UTSW 2 162960070 splice site probably null
R2513:L3mbtl1 UTSW 2 162967585 missense probably benign
R3848:L3mbtl1 UTSW 2 162948201 missense probably damaging 1.00
R4877:L3mbtl1 UTSW 2 162948568 missense probably damaging 0.98
R4930:L3mbtl1 UTSW 2 162965772 missense probably damaging 1.00
R5930:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R5932:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R6562:L3mbtl1 UTSW 2 162970204 missense probably benign 0.28
R6601:L3mbtl1 UTSW 2 162948175 start gained probably benign
R6995:L3mbtl1 UTSW 2 162961448 missense probably damaging 1.00
R7188:L3mbtl1 UTSW 2 162949540 critical splice donor site probably null
R7346:L3mbtl1 UTSW 2 162967006 missense probably benign 0.01
R7379:L3mbtl1 UTSW 2 162960979 missense probably damaging 1.00
R7474:L3mbtl1 UTSW 2 162966604 missense probably damaging 1.00
R7553:L3mbtl1 UTSW 2 162948231 missense probably benign 0.01
R7599:L3mbtl1 UTSW 2 162964514 missense possibly damaging 0.70
R8745:L3mbtl1 UTSW 2 162970217 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCAGACTGTCAGTCAGCCAGAAG -3'
(R):5'- AATACAGGGGCCACCTACAGAGTG -3'

Sequencing Primer
(F):5'- TGAGCCTTAGCCTGAAGAGT -3'
(R):5'- ggcttagagaggcaaaggaac -3'
Posted On2013-09-30