Incidental Mutation 'R0761:Polr1e'
ID70080
Institutional Source Beutler Lab
Gene Symbol Polr1e
Ensembl Gene ENSMUSG00000028318
Gene Namepolymerase (RNA) I polypeptide E
Synonyms53kDa, D030019D19Rik, Paf53, Praf1
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45018583-45036565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45027392 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 207 (D207E)
Ref Sequence ENSEMBL: ENSMUSP00000103444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029999] [ENSMUST00000107814] [ENSMUST00000133157]
Predicted Effect probably benign
Transcript: ENSMUST00000029999
AA Change: D255E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029999
Gene: ENSMUSG00000028318
AA Change: D255E

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 51 476 2.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054723
AA Change: D179E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059941
Gene: ENSMUSG00000028318
AA Change: D179E

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 24 401 7.9e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107814
AA Change: D207E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103444
Gene: ENSMUSG00000028318
AA Change: D207E

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 385 4.1e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133157
AA Change: D207E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121007
Gene: ENSMUSG00000028318
AA Change: D207E

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 431 1.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153252
Meta Mutation Damage Score 0.2878 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Polr1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Polr1e APN 4 45031364 unclassified probably benign
IGL01146:Polr1e APN 4 45031369 missense probably damaging 1.00
IGL01514:Polr1e APN 4 45018723 missense probably benign 0.00
IGL01533:Polr1e APN 4 45019328 missense probably damaging 1.00
R0207:Polr1e UTSW 4 45025143 splice site probably null
R0562:Polr1e UTSW 4 45029421 missense probably damaging 0.99
R1472:Polr1e UTSW 4 45028026 missense probably damaging 1.00
R1707:Polr1e UTSW 4 45027469 missense probably damaging 0.99
R2994:Polr1e UTSW 4 45027473 critical splice donor site probably null
R3054:Polr1e UTSW 4 45018724 missense possibly damaging 0.77
R4031:Polr1e UTSW 4 45018685 missense probably benign 0.02
R4195:Polr1e UTSW 4 45019327 missense probably damaging 1.00
R4771:Polr1e UTSW 4 45019282 missense probably damaging 1.00
R4806:Polr1e UTSW 4 45024482 missense probably benign
R4880:Polr1e UTSW 4 45022280 missense probably damaging 1.00
R4964:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R4966:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R5605:Polr1e UTSW 4 45018723 missense probably benign 0.00
R5934:Polr1e UTSW 4 45029369 missense probably damaging 0.99
R6358:Polr1e UTSW 4 45026813 missense probably damaging 1.00
R7241:Polr1e UTSW 4 45029340 missense probably damaging 1.00
R7436:Polr1e UTSW 4 45024553 splice site probably null
X0061:Polr1e UTSW 4 45029436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATCTCAGCAGGTGTTCACATTCG -3'
(R):5'- GTGACGTTCTAGGTTCCAACCCTTC -3'

Sequencing Primer
(F):5'- GAGTTTCAGAACGTGTGGTCC -3'
(R):5'- TTGCTAACAGCTCTAGGACATGG -3'
Posted On2013-09-30