Incidental Mutation 'R9072:Prkcb'
ID 700809
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Name protein kinase C, beta
Synonyms Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 122288751-122634402 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122528548 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 298 (N298K)
Ref Sequence ENSEMBL: ENSMUSP00000070019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
AlphaFold P68404
Predicted Effect probably benign
Transcript: ENSMUST00000064921
AA Change: N298K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: N298K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064989
AA Change: N298K

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: N298K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143692
AA Change: N298K

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: N298K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,290,834 E899A possibly damaging Het
Best2 T A 8: 85,010,789 I230F probably damaging Het
C2cd2 T C 16: 97,875,203 E448G probably damaging Het
C2cd3 T G 7: 100,391,084 S287A probably benign Het
Camta2 G A 11: 70,676,408 P677S probably benign Het
Cand2 C T 6: 115,792,529 R767C probably damaging Het
Celsr3 G A 9: 108,827,094 E259K probably benign Het
Cep250 C G 2: 155,992,115 Q1987E probably benign Het
Chn1 T C 2: 73,613,086 D440G probably benign Het
Cmbl A T 15: 31,585,303 D111V possibly damaging Het
Col5a3 T A 9: 20,771,157 I1664F unknown Het
Cp T C 3: 19,978,994 S662P possibly damaging Het
Cpne5 G A 17: 29,211,703 R78C probably damaging Het
Cst10 A G 2: 149,407,341 T104A probably benign Het
Cyp11b2 A G 15: 74,853,813 F195S possibly damaging Het
Dcaf17 T C 2: 71,089,792 Y475H probably benign Het
Edem2 G C 2: 155,729,292 L16V unknown Het
Ext2 A G 2: 93,813,799 W46R probably benign Het
Fam102a A G 2: 32,565,662 S267G probably benign Het
Fam71e2 A T 7: 4,759,254 H265Q Het
Gal3st3 T A 19: 5,302,577 S11T probably benign Het
Gfi1 T A 5: 107,717,859 I451F possibly damaging Het
Gfpt2 T C 11: 49,823,358 L314P probably damaging Het
Gm3250 A T 10: 77,782,293 C84S unknown Het
Gm4858 T A 3: 93,074,034 C46S probably benign Het
Hmcn1 A T 1: 150,689,569 V2269E probably benign Het
Ighv1-55 T C 12: 115,208,393 H18R probably benign Het
Iqgap3 G A 3: 88,091,576 G328E probably benign Het
Klf6 G T 13: 5,867,234 C303F probably benign Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Ktn1 T G 14: 47,704,237 V822G probably benign Het
Lbhd2 G T 12: 111,408,606 G21W probably damaging Het
Lrp1b G A 2: 40,725,445 R3649* probably null Het
Map2 C A 1: 66,414,153 T734N probably damaging Het
Mas1 A G 17: 12,841,952 F195L possibly damaging Het
Med1 A T 11: 98,189,183 M44K possibly damaging Het
Morc3 T C 16: 93,870,594 V620A probably benign Het
Naip2 C T 13: 100,154,951 D1160N probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Nucb2 T A 7: 116,526,396 I159N probably damaging Het
Olfm5 A G 7: 104,153,777 L493P probably benign Het
Olfr20 T G 11: 73,353,971 F73V probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr697 A T 7: 106,741,552 C127* probably null Het
Pcdhb22 T A 18: 37,518,760 C94S probably damaging Het
Pcdhga5 A G 18: 37,696,484 I662V probably benign Het
Plcb2 G A 2: 118,717,397 T472M possibly damaging Het
Plcb4 A G 2: 136,007,875 E1142G possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Polr2l T C 7: 141,473,372 Y43C probably damaging Het
Ptar1 T A 19: 23,718,050 C294S probably benign Het
Ptprq T C 10: 107,565,875 I1919V Het
Slc25a18 C T 6: 120,792,061 R180C probably benign Het
Slc27a3 A C 3: 90,388,461 S285R probably damaging Het
Smg1 C T 7: 118,183,809 V1092I unknown Het
Spata19 T G 9: 27,397,728 I54R possibly damaging Het
St6galnac5 T C 3: 152,846,319 T204A probably benign Het
Trpc3 T C 3: 36,640,682 I708V probably benign Het
Ttn T C 2: 76,944,839 E1999G unknown Het
Ube3b C T 5: 114,404,546 T488M probably damaging Het
Vmn1r235 A T 17: 21,262,009 I199F probably benign Het
Vsig8 A T 1: 172,560,773 N215Y possibly damaging Het
Wapl A G 14: 34,677,460 K162R possibly damaging Het
Wdpcp A G 11: 21,664,014 T60A probably benign Het
Wdr26 A T 1: 181,182,786 I566N probably damaging Het
Wdr46 C T 17: 33,944,581 T371M probably benign Het
Zdbf2 T C 1: 63,305,764 S1101P possibly damaging Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site probably benign
IGL02962:Prkcb APN 7 122425047 splice site probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Baghdad UTSW 7 122627663 missense probably benign 0.07
Mesopotamia UTSW 7 122289514 missense probably damaging 1.00
Mosul UTSW 7 122516844 missense probably damaging 1.00
tigris UTSW 7 122424977 missense probably damaging 1.00
Tikrit UTSW 7 122627693 missense probably damaging 1.00
untied UTSW 7 122582439 missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
R6257:Prkcb UTSW 7 122568163 missense probably benign
R6590:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6618:Prkcb UTSW 7 122627663 missense probably benign 0.07
R6690:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6763:Prkcb UTSW 7 122594664 missense probably damaging 1.00
R7289:Prkcb UTSW 7 122544687 missense probably benign 0.04
R7414:Prkcb UTSW 7 122568227 missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122516844 missense probably damaging 1.00
R7540:Prkcb UTSW 7 122568134 missense probably damaging 0.99
R8283:Prkcb UTSW 7 122600725 nonsense probably null
R9483:Prkcb UTSW 7 122582440 missense probably damaging 0.99
R9670:Prkcb UTSW 7 122633847 nonsense probably null
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Z1177:Prkcb UTSW 7 122568196 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAGGCATGCAAGTACTAAGC -3'
(R):5'- AGCATCACAGAGTCTGAACCAG -3'

Sequencing Primer
(F):5'- GCATTGCGGAGACTTGAACTC -3'
(R):5'- TCACAGAGTCTGAACCAGTACAGAG -3'
Posted On 2022-02-07