Incidental Mutation 'R0761:Tnfrsf1b'
ID70082
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1b
Ensembl Gene ENSMUSG00000028599
Gene Nametumor necrosis factor receptor superfamily, member 1b
SynonymsTNFalpha-R2, TNFBR, CD120b, TNFR80, TNF-R-II, TNF-R75, p75 TNFR, Tnfr2, p75, TNF-R2, TNFRII, TNF-alphaR2
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location145213463-145246870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145216100 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 371 (D371G)
Ref Sequence ENSEMBL: ENSMUSP00000030336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030336]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030336
AA Change: D371G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030336
Gene: ENSMUSG00000028599
AA Change: D371G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TNFR 40 76 2.15e-9 SMART
TNFR 79 119 2.19e-10 SMART
TNFR 121 163 7.27e-7 SMART
TNFR 166 202 2.22e-2 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered inflammatory responses in a variety of experimental conditions, impaired recovery from spinal cord injury, enhanced ischemia-reperfusion-induced retinal damage, and resistance to cerebral malaria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Tnfrsf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Tnfrsf1b APN 4 145225416 missense probably damaging 1.00
IGL01716:Tnfrsf1b APN 4 145215923 missense probably damaging 0.97
IGL01974:Tnfrsf1b APN 4 145215851 missense probably damaging 1.00
IGL02631:Tnfrsf1b APN 4 145224828 missense probably damaging 1.00
R0011:Tnfrsf1b UTSW 4 145222966 missense possibly damaging 0.77
R0135:Tnfrsf1b UTSW 4 145229046 missense probably benign 0.15
R0194:Tnfrsf1b UTSW 4 145224812 missense probably benign 0.04
R1124:Tnfrsf1b UTSW 4 145224356 missense probably benign 0.23
R1696:Tnfrsf1b UTSW 4 145227474 missense probably benign
R3692:Tnfrsf1b UTSW 4 145227522 missense probably benign 0.01
R4248:Tnfrsf1b UTSW 4 145215965 missense probably benign 0.01
R4409:Tnfrsf1b UTSW 4 145224285 nonsense probably null
R4957:Tnfrsf1b UTSW 4 145246757 missense probably damaging 0.99
R4957:Tnfrsf1b UTSW 4 145246758 missense possibly damaging 0.90
R5180:Tnfrsf1b UTSW 4 145227497 missense probably damaging 1.00
R5425:Tnfrsf1b UTSW 4 145229108 critical splice acceptor site probably null
R6163:Tnfrsf1b UTSW 4 145219907 missense probably benign 0.24
R7055:Tnfrsf1b UTSW 4 145224887 missense probably damaging 1.00
R7891:Tnfrsf1b UTSW 4 145229090 missense probably damaging 1.00
R8796:Tnfrsf1b UTSW 4 145219915 missense possibly damaging 0.95
R8919:Tnfrsf1b UTSW 4 145223580 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCAATCTGATCAAACCAGCC -3'
(R):5'- TCTGCCATCGTAGTAGAGGTGAGC -3'

Sequencing Primer
(F):5'- TCTGTAGTCTCACACGGGG -3'
(R):5'- TAGTAGAGGTGAGCTAGGGTC -3'
Posted On2013-09-30