Incidental Mutation 'R9072:Wapl'
ID 700828
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34677460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 162 (K162R)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: K162R

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: K162R

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090027
AA Change: K162R

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: K162R

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: K162R

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: K162R

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,290,834 E899A possibly damaging Het
Best2 T A 8: 85,010,789 I230F probably damaging Het
C2cd2 T C 16: 97,875,203 E448G probably damaging Het
C2cd3 T G 7: 100,391,084 S287A probably benign Het
Camta2 G A 11: 70,676,408 P677S probably benign Het
Cand2 C T 6: 115,792,529 R767C probably damaging Het
Celsr3 G A 9: 108,827,094 E259K probably benign Het
Cep250 C G 2: 155,992,115 Q1987E probably benign Het
Chn1 T C 2: 73,613,086 D440G probably benign Het
Cmbl A T 15: 31,585,303 D111V possibly damaging Het
Col5a3 T A 9: 20,771,157 I1664F unknown Het
Cp T C 3: 19,978,994 S662P possibly damaging Het
Cpne5 G A 17: 29,211,703 R78C probably damaging Het
Cst10 A G 2: 149,407,341 T104A probably benign Het
Cyp11b2 A G 15: 74,853,813 F195S possibly damaging Het
Dcaf17 T C 2: 71,089,792 Y475H probably benign Het
Edem2 G C 2: 155,729,292 L16V unknown Het
Ext2 A G 2: 93,813,799 W46R probably benign Het
Fam102a A G 2: 32,565,662 S267G probably benign Het
Fam71e2 A T 7: 4,759,254 H265Q Het
Gal3st3 T A 19: 5,302,577 S11T probably benign Het
Gfi1 T A 5: 107,717,859 I451F possibly damaging Het
Gfpt2 T C 11: 49,823,358 L314P probably damaging Het
Gm3250 A T 10: 77,782,293 C84S unknown Het
Gm4858 T A 3: 93,074,034 C46S probably benign Het
Hmcn1 A T 1: 150,689,569 V2269E probably benign Het
Ighv1-55 T C 12: 115,208,393 H18R probably benign Het
Iqgap3 G A 3: 88,091,576 G328E probably benign Het
Klf6 G T 13: 5,867,234 C303F probably benign Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Ktn1 T G 14: 47,704,237 V822G probably benign Het
Lbhd2 G T 12: 111,408,606 G21W probably damaging Het
Lrp1b G A 2: 40,725,445 R3649* probably null Het
Map2 C A 1: 66,414,153 T734N probably damaging Het
Mas1 A G 17: 12,841,952 F195L possibly damaging Het
Med1 A T 11: 98,189,183 M44K possibly damaging Het
Morc3 T C 16: 93,870,594 V620A probably benign Het
Naip2 C T 13: 100,154,951 D1160N probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Nucb2 T A 7: 116,526,396 I159N probably damaging Het
Olfm5 A G 7: 104,153,777 L493P probably benign Het
Olfr20 T G 11: 73,353,971 F73V probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr697 A T 7: 106,741,552 C127* probably null Het
Pcdhb22 T A 18: 37,518,760 C94S probably damaging Het
Pcdhga5 A G 18: 37,696,484 I662V probably benign Het
Plcb2 G A 2: 118,717,397 T472M possibly damaging Het
Plcb4 A G 2: 136,007,875 E1142G possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Polr2l T C 7: 141,473,372 Y43C probably damaging Het
Prkcb T A 7: 122,528,548 N298K probably benign Het
Ptar1 T A 19: 23,718,050 C294S probably benign Het
Ptprq T C 10: 107,565,875 I1919V Het
Slc25a18 C T 6: 120,792,061 R180C probably benign Het
Slc27a3 A C 3: 90,388,461 S285R probably damaging Het
Smg1 C T 7: 118,183,809 V1092I unknown Het
Spata19 T G 9: 27,397,728 I54R possibly damaging Het
St6galnac5 T C 3: 152,846,319 T204A probably benign Het
Trpc3 T C 3: 36,640,682 I708V probably benign Het
Ttn T C 2: 76,944,839 E1999G unknown Het
Ube3b C T 5: 114,404,546 T488M probably damaging Het
Vmn1r235 A T 17: 21,262,009 I199F probably benign Het
Vsig8 A T 1: 172,560,773 N215Y possibly damaging Het
Wdpcp A G 11: 21,664,014 T60A probably benign Het
Wdr26 A T 1: 181,182,786 I566N probably damaging Het
Wdr46 C T 17: 33,944,581 T371M probably benign Het
Zdbf2 T C 1: 63,305,764 S1101P possibly damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R8988:Wapl UTSW 14 34729182 missense probably damaging 1.00
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9259:Wapl UTSW 14 34741095 missense probably benign 0.00
R9545:Wapl UTSW 14 34677093 missense probably damaging 1.00
R9613:Wapl UTSW 14 34731563 missense probably benign 0.29
R9624:Wapl UTSW 14 34692106 missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCTGGAAGAAGTCACTTC -3'
(R):5'- TCCTCTACTAATCATAAATGCAGGG -3'

Sequencing Primer
(F):5'- TCACTTCTGTATTTGAAGCTAATAGC -3'
(R):5'- CAGGACTCATTTTGCAGACCAGG -3'
Posted On 2022-02-07