Incidental Mutation 'R8933:Stra8'
ID 700845
Institutional Source Beutler Lab
Gene Symbol Stra8
Ensembl Gene ENSMUSG00000029848
Gene Name stimulated by retinoic acid gene 8
Synonyms
MMRRC Submission 068709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34897098-34916279 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 34904624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031876] [ENSMUST00000114997] [ENSMUST00000114999] [ENSMUST00000185102]
AlphaFold P70278
Predicted Effect probably benign
Transcript: ENSMUST00000031876
SMART Domains Protein: ENSMUSP00000031876
Gene: ENSMUSG00000029848

DomainStartEndE-ValueType
Blast:HLH 34 83 5e-20 BLAST
coiled coil region 159 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114997
SMART Domains Protein: ENSMUSP00000110649
Gene: ENSMUSG00000029848

DomainStartEndE-ValueType
coiled coil region 48 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114999
SMART Domains Protein: ENSMUSP00000110651
Gene: ENSMUSG00000029848

DomainStartEndE-ValueType
Blast:HLH 34 83 5e-20 BLAST
coiled coil region 159 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185102
SMART Domains Protein: ENSMUSP00000139136
Gene: ENSMUSG00000029848

DomainStartEndE-ValueType
low complexity region 122 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid-responsive protein. A homologous protein in mouse has been shown to be involved in the regulation of meiotic initiation in both spermatogenesis and oogenesis, though feature differences between the mouse and human proteins suggest that these homologs are not entirely functionally equivalent. It is thought that this gene may play a role in spermatogenesis in humans. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice display impaired meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,921,786 (GRCm39) I1114N probably damaging Het
Ache C A 5: 137,288,449 (GRCm39) R52S possibly damaging Het
AI182371 A T 2: 34,975,714 (GRCm39) probably null Het
Ankrd17 T C 5: 90,406,325 (GRCm39) S1453G probably damaging Het
Arvcf A G 16: 18,218,845 (GRCm39) N508S probably damaging Het
Aurkc A C 7: 7,005,796 (GRCm39) D136A possibly damaging Het
Bfsp2 A G 9: 103,325,848 (GRCm39) M265T probably benign Het
Bmpr1b T C 3: 141,562,369 (GRCm39) T273A probably damaging Het
Cacnb1 T C 11: 97,896,578 (GRCm39) K406R probably damaging Het
Calcoco2 C T 11: 95,998,252 (GRCm39) probably benign Het
Capza1 T C 3: 104,748,209 (GRCm39) probably null Het
Ccdc63 T A 5: 122,251,265 (GRCm39) I382F probably damaging Het
Cep350 A T 1: 155,739,161 (GRCm39) N2227K probably benign Het
Chia1 T A 3: 106,036,333 (GRCm39) Y304* probably null Het
Col5a2 G A 1: 45,461,123 (GRCm39) P258L Het
Cyp21a1 A G 17: 35,023,285 (GRCm39) L30P probably damaging Het
Dennd4b T A 3: 90,186,523 (GRCm39) H1351Q probably benign Het
Dnah9 T A 11: 65,746,078 (GRCm39) I4012F possibly damaging Het
Drd1 A G 13: 54,207,290 (GRCm39) I301T possibly damaging Het
Dzip1 T A 14: 119,144,326 (GRCm39) H369L probably damaging Het
Fgfrl1 T A 5: 108,851,257 (GRCm39) M58K probably damaging Het
Ftsj3 G T 11: 106,141,660 (GRCm39) D529E probably benign Het
Fut9 A T 4: 25,619,861 (GRCm39) W318R probably damaging Het
Gabrg3 A G 7: 56,634,706 (GRCm39) I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 (GRCm39) D53V probably benign Het
Ggps1 A G 13: 14,228,928 (GRCm39) V85A probably benign Het
Gm5141 C T 13: 62,924,854 (GRCm39) W18* probably null Het
Grik5 T A 7: 24,722,743 (GRCm39) T518S probably benign Het
Hapln3 A T 7: 78,767,378 (GRCm39) probably benign Het
Hbs1l C T 10: 21,243,584 (GRCm39) Q646* probably null Het
Hmox1 T C 8: 75,823,644 (GRCm39) I104T probably benign Het
Ifit1bl1 T C 19: 34,571,413 (GRCm39) Y348C probably damaging Het
Igf2r A T 17: 12,920,131 (GRCm39) S1403T probably damaging Het
Igf2r G A 17: 12,923,524 (GRCm39) T1186M probably damaging Het
Igfbp1 T C 11: 7,148,333 (GRCm39) probably null Het
Ikbip C A 10: 90,919,092 (GRCm39) A35E probably benign Het
Isca1 C T 13: 59,917,497 (GRCm39) A8T probably damaging Het
Itgb2 T C 10: 77,401,022 (GRCm39) L754P probably damaging Het
Itgb6 C T 2: 60,458,247 (GRCm39) C502Y probably damaging Het
Kdm3a A G 6: 71,577,092 (GRCm39) V741A probably benign Het
Kdsr T C 1: 106,680,949 (GRCm39) D83G possibly damaging Het
Kiz T A 2: 146,784,037 (GRCm39) N523K Het
Kmt2a T C 9: 44,733,802 (GRCm39) probably benign Het
Krt25 T C 11: 99,212,064 (GRCm39) E191G probably benign Het
Lipn A G 19: 34,046,880 (GRCm39) I61V probably damaging Het
Lmbr1l T A 15: 98,807,150 (GRCm39) probably null Het
Lrrc4c A G 2: 97,459,826 (GRCm39) K151E probably benign Het
Mab21l3 T C 3: 101,730,774 (GRCm39) Q155R probably benign Het
Mtfr2 G A 10: 20,233,274 (GRCm39) R281H possibly damaging Het
Muc5ac A G 7: 141,343,493 (GRCm39) Y35C possibly damaging Het
Myadm C T 7: 3,345,433 (GRCm39) T65I probably benign Het
Nap1l1 T C 10: 111,328,710 (GRCm39) V213A probably benign Het
Nav2 A G 7: 49,111,705 (GRCm39) D737G probably damaging Het
Ndst4 T A 3: 125,405,155 (GRCm39) V470D probably damaging Het
Nek5 T A 8: 22,601,226 (GRCm39) Y165F probably damaging Het
Nek5 A T 8: 22,610,859 (GRCm39) V48E probably damaging Het
Nr6a1 T C 2: 38,650,400 (GRCm39) I77V probably damaging Het
Nvl A T 1: 180,966,638 (GRCm39) D93E probably benign Het
Or11a4 C A 17: 37,536,346 (GRCm39) T110K possibly damaging Het
Or2q1 A G 6: 42,794,950 (GRCm39) T182A probably benign Het
Or52e5 A G 7: 104,718,599 (GRCm39) probably benign Het
Or52k2 A T 7: 102,253,637 (GRCm39) L25F probably damaging Het
Or52p1 A T 7: 104,266,873 (GRCm39) T4S probably benign Het
Or6c68 A T 10: 129,158,259 (GRCm39) I256F probably damaging Het
Pla2g4c G A 7: 13,073,627 (GRCm39) V225I probably benign Het
Plppr4 T A 3: 117,116,690 (GRCm39) N331I probably damaging Het
Ptpn13 A G 5: 103,727,671 (GRCm39) R2051G probably benign Het
Rbm45 T C 2: 76,209,068 (GRCm39) S346P probably damaging Het
Samd14 A C 11: 94,912,027 (GRCm39) D168A probably damaging Het
Slc15a1 C T 14: 121,724,091 (GRCm39) G172R probably benign Het
Slco3a1 G T 7: 73,934,248 (GRCm39) Y641* probably null Het
Srcap G A 7: 127,151,566 (GRCm39) R2027H probably damaging Het
Syt11 T C 3: 88,655,011 (GRCm39) Y430C probably damaging Het
Tanc1 T G 2: 59,615,800 (GRCm39) V269G possibly damaging Het
Tead1 A G 7: 112,497,818 (GRCm39) N342S probably benign Het
Tenm3 C T 8: 48,732,095 (GRCm39) A1254T possibly damaging Het
Txlnb A T 10: 17,682,546 (GRCm39) N156I probably damaging Het
Ufl1 A T 4: 25,262,258 (GRCm39) S409R possibly damaging Het
Usp17la A G 7: 104,510,307 (GRCm39) H304R probably benign Het
Vmn1r203 T A 13: 22,708,691 (GRCm39) H157Q possibly damaging Het
Vmn1r37 C T 6: 66,709,231 (GRCm39) R249* probably null Het
Vmn2r96 A G 17: 18,804,241 (GRCm39) Q497R probably benign Het
Vps39 A G 2: 120,169,066 (GRCm39) S292P probably benign Het
Wnk1 A G 6: 120,013,959 (GRCm39) V212A probably damaging Het
Xbp1 T C 11: 5,474,741 (GRCm39) V161A probably benign Het
Zfp113 T C 5: 138,143,092 (GRCm39) Q386R probably damaging Het
Other mutations in Stra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Stra8 APN 6 34,914,998 (GRCm39) missense probably benign 0.09
IGL01336:Stra8 APN 6 34,910,123 (GRCm39) missense possibly damaging 0.75
IGL02110:Stra8 APN 6 34,907,289 (GRCm39) splice site probably benign
IGL02572:Stra8 APN 6 34,916,094 (GRCm39) missense probably damaging 1.00
rounded UTSW 6 34,909,975 (GRCm39) nonsense probably null
R1740:Stra8 UTSW 6 34,904,654 (GRCm39) splice site probably benign
R4928:Stra8 UTSW 6 34,910,091 (GRCm39) missense probably benign 0.03
R5412:Stra8 UTSW 6 34,907,885 (GRCm39) start codon destroyed probably null 0.46
R5709:Stra8 UTSW 6 34,904,697 (GRCm39) missense possibly damaging 0.73
R6558:Stra8 UTSW 6 34,909,975 (GRCm39) nonsense probably null
R7081:Stra8 UTSW 6 34,911,302 (GRCm39) critical splice donor site probably null
R7673:Stra8 UTSW 6 34,904,853 (GRCm39) critical splice donor site probably null
R7845:Stra8 UTSW 6 34,907,899 (GRCm39) missense probably benign 0.23
R7946:Stra8 UTSW 6 34,907,816 (GRCm39) critical splice acceptor site probably null
R8773:Stra8 UTSW 6 34,912,581 (GRCm39) missense probably damaging 0.98
R9149:Stra8 UTSW 6 34,911,016 (GRCm39) missense probably damaging 1.00
R9484:Stra8 UTSW 6 34,911,121 (GRCm39) missense probably damaging 1.00
R9512:Stra8 UTSW 6 34,909,988 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACCAGTCAAGAGGGTTTGGG -3'
(R):5'- TTAGGTTGTTGAAGAGCCCTACC -3'

Sequencing Primer
(F):5'- TTTCATGACTCACCGGACAACTG -3'
(R):5'- TACCAGGGTGGCTCGATG -3'
Posted On 2022-02-10