Mutagenetix > Incidental Mutation

Incidental Mutation 'R8933:Stra8'

700845

Institutional Source

Beutler Lab

Gene Symbol

Stra8

Ensembl Gene

ENSMUSG00000029848

Gene Name

stimulated by retinoic acid gene 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.245) question?

Stock #

R8933 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34920163-34939344 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 34927689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031876] [ENSMUST00000114997] [ENSMUST00000114999] [ENSMUST00000185102]

AlphaFold

P70278

Predicted Effect

probably benign
Transcript: ENSMUST00000031876

SMART Domains

Protein: ENSMUSP00000031876
Gene: ENSMUSG00000029848

Domain	Start	End	E-Value	Type
Blast:HLH	34	83	5e-20	BLAST
coiled coil region	159	201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114997

SMART Domains

Protein: ENSMUSP00000110649
Gene: ENSMUSG00000029848

Domain	Start	End	E-Value	Type
coiled coil region	48	90	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114999

SMART Domains

Protein: ENSMUSP00000110651
Gene: ENSMUSG00000029848

Domain	Start	End	E-Value	Type
Blast:HLH	34	83	5e-20	BLAST
coiled coil region	159	201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185102

SMART Domains

Protein: ENSMUSP00000139136
Gene: ENSMUSG00000029848

Domain	Start	End	E-Value	Type
low complexity region	122	146	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid-responsive protein. A homologous protein in mouse has been shown to be involved in the regulation of meiotic initiation in both spermatogenesis and oogenesis, though feature differences between the mouse and human proteins suggest that these homologs are not entirely functionally equivalent. It is thought that this gene may play a role in spermatogenesis in humans. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice display impaired meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,128,137	I1114N	probably damaging	Het
Ache	C	A	5: 137,290,187	R52S	possibly damaging	Het
AI182371	A	T	2: 35,085,702		probably null	Het
Ankrd17	T	C	5: 90,258,466	S1453G	probably damaging	Het
Arvcf	A	G	16: 18,400,095	N508S	probably damaging	Het
Aurkc	A	C	7: 7,002,797	D136A	possibly damaging	Het
Bfsp2	A	G	9: 103,448,649	M265T	probably benign	Het
Bmpr1b	T	C	3: 141,856,608	T273A	probably damaging	Het
Cacnb1	T	C	11: 98,005,752	K406R	probably damaging	Het
Calcoco2	C	T	11: 96,107,426		probably benign	Het
Capza1	T	C	3: 104,840,893		probably null	Het
Ccdc63	T	A	5: 122,113,202	I382F	probably damaging	Het
Cep350	A	T	1: 155,863,415	N2227K	probably benign	Het
Chia1	T	A	3: 106,129,017	Y304*	probably null	Het
Col5a2	G	A	1: 45,421,963	P258L		Het
Cyp21a1	A	G	17: 34,804,311	L30P	probably damaging	Het
Dennd4b	T	A	3: 90,279,216	H1351Q	probably benign	Het
Dnah9	T	A	11: 65,855,252	I4012F	possibly damaging	Het
Drd1	A	G	13: 54,053,271	I301T	possibly damaging	Het
Dzip1	T	A	14: 118,906,914	H369L	probably damaging	Het
Fgfrl1	T	A	5: 108,703,391	M58K	probably damaging	Het
Ftsj3	G	T	11: 106,250,834	D529E	probably benign	Het
Fut9	A	T	4: 25,619,861	W318R	probably damaging	Het
Gabrg3	A	G	7: 56,984,958	I159T	probably damaging	Het
Gabrr1	A	T	4: 33,146,972	D53V	probably benign	Het
Ggps1	A	G	13: 14,054,343	V85A	probably benign	Het
Gm5141	C	T	13: 62,777,040	W18*	probably null	Het
Grik5	T	A	7: 25,023,318	T518S	probably benign	Het
Hapln3	A	T	7: 79,117,630		probably benign	Het
Hbs1l	C	T	10: 21,367,685	Q646*	probably null	Het
Hmox1	T	C	8: 75,097,016	I104T	probably benign	Het
Ifit1bl1	T	C	19: 34,594,013	Y348C	probably damaging	Het
Igf2r	A	T	17: 12,701,244	S1403T	probably damaging	Het
Igf2r	G	A	17: 12,704,637	T1186M	probably damaging	Het
Igfbp1	T	C	11: 7,198,333		probably null	Het
Ikbip	C	A	10: 91,083,230	A35E	probably benign	Het
Isca1	C	T	13: 59,769,683	A8T	probably damaging	Het
Itgb2	T	C	10: 77,565,188	L754P	probably damaging	Het
Itgb6	C	T	2: 60,627,903	C502Y	probably damaging	Het
Kdm3a	A	G	6: 71,600,108	V741A	probably benign	Het
Kdsr	T	C	1: 106,753,219	D83G	possibly damaging	Het
Kiz	T	A	2: 146,942,117	N523K		Het
Kmt2a	T	C	9: 44,822,505		probably benign	Het
Krt25	T	C	11: 99,321,238	E191G	probably benign	Het
Lipn	A	G	19: 34,069,480	I61V	probably damaging	Het
Lmbr1l	T	A	15: 98,909,269		probably null	Het
Lrrc4c	A	G	2: 97,629,481	K151E	probably benign	Het
Mab21l3	T	C	3: 101,823,458	Q155R	probably benign	Het
Mtfr2	G	A	10: 20,357,528	R281H	possibly damaging	Het
Muc5ac	A	G	7: 141,789,756	Y35C	possibly damaging	Het
Myadm	C	T	7: 3,296,917	T65I	probably benign	Het
Nap1l1	T	C	10: 111,492,849	V213A	probably benign	Het
Nav2	A	G	7: 49,461,957	D737G	probably damaging	Het
Ndst4	T	A	3: 125,611,506	V470D	probably damaging	Het
Nek5	T	A	8: 22,111,210	Y165F	probably damaging	Het
Nek5	A	T	8: 22,120,843	V48E	probably damaging	Het
Nr6a1	T	C	2: 38,760,388	I77V	probably damaging	Het
Nvl	A	T	1: 181,139,073	D93E	probably benign	Het
Olfr450	A	G	6: 42,818,016	T182A	probably benign	Het
Olfr552	A	T	7: 102,604,430	L25F	probably damaging	Het
Olfr656	A	T	7: 104,617,666	T4S	probably benign	Het
Olfr678	A	G	7: 105,069,392		probably benign	Het
Olfr780	A	T	10: 129,322,390	I256F	probably damaging	Het
Olfr96	C	A	17: 37,225,455	T110K	possibly damaging	Het
Pla2g4c	G	A	7: 13,339,702	V225I	probably benign	Het
Plppr4	T	A	3: 117,323,041	N331I	probably damaging	Het
Ptpn13	A	G	5: 103,579,805	R2051G	probably benign	Het
Rbm45	T	C	2: 76,378,724	S346P	probably damaging	Het
Samd14	A	C	11: 95,021,201	D168A	probably damaging	Het
Slc15a1	C	T	14: 121,486,679	G172R	probably benign	Het
Slco3a1	G	T	7: 74,284,500	Y641*	probably null	Het
Srcap	G	A	7: 127,552,394	R2027H	probably damaging	Het
Syt11	T	C	3: 88,747,704	Y430C	probably damaging	Het
Tanc1	T	G	2: 59,785,456	V269G	possibly damaging	Het
Tead1	A	G	7: 112,898,611	N342S	probably benign	Het
Tenm3	C	T	8: 48,279,060	A1254T	possibly damaging	Het
Txlnb	A	T	10: 17,806,798	N156I	probably damaging	Het
Ufl1	A	T	4: 25,262,258	S409R	possibly damaging	Het
Usp17la	A	G	7: 104,861,100	H304R	probably benign	Het
Vmn1r203	T	A	13: 22,524,521	H157Q	possibly damaging	Het
Vmn1r37	C	T	6: 66,732,247	R249*	probably null	Het
Vmn2r96	A	G	17: 18,583,979	Q497R	probably benign	Het
Vps39	A	G	2: 120,338,585	S292P	probably benign	Het
Wnk1	A	G	6: 120,036,998	V212A	probably damaging	Het
Xbp1	T	C	11: 5,524,741	V161A	probably benign	Het
Zfp113	T	C	5: 138,144,830	Q386R	probably damaging	Het

Other mutations in Stra8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Stra8	APN	6	34938063	missense	probably benign	0.09
IGL01336:Stra8	APN	6	34933188	missense	possibly damaging	0.75
IGL02110:Stra8	APN	6	34930354	splice site	probably benign
IGL02572:Stra8	APN	6	34939159	missense	probably damaging	1.00
rounded	UTSW	6	34933040	nonsense	probably null
R1740:Stra8	UTSW	6	34927719	splice site	probably benign
R4928:Stra8	UTSW	6	34933156	missense	probably benign	0.03
R5412:Stra8	UTSW	6	34930950	start codon destroyed	probably null	0.46
R5709:Stra8	UTSW	6	34927762	missense	possibly damaging	0.73
R6558:Stra8	UTSW	6	34933040	nonsense	probably null
R7081:Stra8	UTSW	6	34934367	critical splice donor site	probably null
R7673:Stra8	UTSW	6	34927918	critical splice donor site	probably null
R7845:Stra8	UTSW	6	34930964	missense	probably benign	0.23
R7946:Stra8	UTSW	6	34930881	critical splice acceptor site	probably null
R8773:Stra8	UTSW	6	34935646	missense	probably damaging	0.98
R9149:Stra8	UTSW	6	34934081	missense	probably damaging	1.00
R9484:Stra8	UTSW	6	34934186	missense	probably damaging	1.00
R9512:Stra8	UTSW	6	34933053	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACCAGTCAAGAGGGTTTGGG -3'
(R):5'- TTAGGTTGTTGAAGAGCCCTACC -3'

Sequencing Primer
(F):5'- TTTCATGACTCACCGGACAACTG -3'
(R):5'- TACCAGGGTGGCTCGATG -3'

Posted On

2022-02-10