Incidental Mutation 'R8913:Mroh2b'
ID 700849
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R8913 (G1)
Quality Score 195.009
Status Validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 4917528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably benign
Transcript: ENSMUST00000045736
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,264,813 Y2102H probably damaging Het
Adam30 A T 3: 98,161,264 I10F possibly damaging Het
Afap1l1 C T 18: 61,756,839 probably null Het
Asz1 T C 6: 18,054,571 D411G probably benign Het
Atp8b2 A G 3: 89,945,523 L144P Het
Atxn7l3 G T 11: 102,294,961 N13K probably damaging Het
Cap1 C A 4: 122,867,652 probably null Het
Cd244 T A 1: 171,574,206 Y167N probably damaging Het
Cd244 A T 1: 171,574,207 Y167F probably damaging Het
Cd302 A G 2: 60,257,897 F92S probably damaging Het
Cep128 C T 12: 91,364,447 probably null Het
Csmd2 C A 4: 128,523,558 P2770T Het
Cyp4f40 G T 17: 32,667,836 D122Y probably benign Het
Dnah14 A G 1: 181,725,498 E2583G probably benign Het
Dync1h1 T C 12: 110,658,168 V3714A probably benign Het
Fam114a1 G T 5: 65,028,478 A381S possibly damaging Het
Fam208a A T 14: 27,466,188 N864Y probably damaging Het
Fzd8 A G 18: 9,213,869 Y317C probably damaging Het
Igfn1 T C 1: 135,963,841 K2312R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klhl23 G A 2: 69,833,890 E528K probably damaging Het
Lama4 T C 10: 39,106,043 V1756A probably benign Het
Lcn2 C A 2: 32,387,146 V53F possibly damaging Het
Lrp4 T C 2: 91,501,440 S1633P probably benign Het
Map3k19 A G 1: 127,822,626 V996A probably benign Het
Mettl9 T G 7: 121,076,316 F313C probably damaging Het
Mios T A 6: 8,215,924 H373Q probably benign Het
Myo1a T C 10: 127,705,841 V83A probably benign Het
Naxe T C 3: 88,058,358 T45A probably benign Het
Nckap1 A G 2: 80,571,220 V40A possibly damaging Het
Nmt1 G T 11: 103,057,445 R265L probably damaging Het
Nwd2 C A 5: 63,806,097 A1008D possibly damaging Het
Obsl1 C T 1: 75,491,248 A1334T probably benign Het
Olfr1209 A G 2: 88,909,647 F249L probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1361 A G 13: 21,659,104 F73S probably damaging Het
Olfr517 A T 7: 108,868,602 V184E probably damaging Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Oplah T C 15: 76,297,480 M1114V Het
Pdlim5 A T 3: 142,244,905 F582L probably damaging Het
Plcb2 A G 2: 118,713,884 F671L probably damaging Het
Ppfibp1 T A 6: 147,022,449 V725E probably damaging Het
Psmd11 C T 11: 80,471,512 T396I probably damaging Het
Ptn C T 6: 36,741,341 D130N probably benign Het
Rasgrf2 T C 13: 92,022,526 D473G probably benign Het
Robo1 A C 16: 72,904,734 I163L probably damaging Het
Ror1 A C 4: 100,407,830 D167A possibly damaging Het
Rps6ka5 T C 12: 100,554,336 D709G Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Runx2 T C 17: 44,608,282 T472A probably benign Het
Scn11a T C 9: 119,794,028 T582A probably damaging Het
Serpina3m C T 12: 104,389,218 A48V probably benign Het
Slc9a3r2 G A 17: 24,644,865 S12L probably benign Het
Smim8 T A 4: 34,769,056 D76V possibly damaging Het
Sqor A G 2: 122,799,886 K260R probably benign Het
Syde2 A T 3: 146,002,393 I963F probably damaging Het
Tenm4 G A 7: 96,702,745 probably benign Het
Tm7sf3 A T 6: 146,626,123 Y68* probably null Het
Tmtc2 T A 10: 105,323,026 I569F probably damaging Het
Upf3a G A 8: 13,795,728 V276M possibly damaging Het
Vmn1r174 G A 7: 23,753,950 V14M possibly damaging Het
Vmn2r104 A G 17: 20,029,706 S768P probably damaging Het
Vmn2r60 A T 7: 42,136,354 T194S probably benign Het
Zfhx2 A G 14: 55,072,086 M852T probably benign Het
Zfp207 T A 11: 80,385,918 D19E probably damaging Het
Zfp318 G A 17: 46,411,773 M1567I probably benign Het
Zfp407 T A 18: 84,560,528 E820V probably damaging Het
Zfp512b A T 2: 181,585,489 C46S Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4935300 missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8910:Mroh2b UTSW 15 4931373 missense probably benign 0.01
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4951184 missense probably benign
R9429:Mroh2b UTSW 15 4934425 missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4944339 missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4931341 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGAATTTTCCCCGGGC -3'
(R):5'- TACGCATGAGATTCTGTACACG -3'

Sequencing Primer
(F):5'- CCCTGCGGTGATGGTGAAAATTAC -3'
(R):5'- TAGGTCTGAACCTGCATC -3'
Posted On 2022-02-10