Mutagenetix > Incidental Mutations

Incidental Mutation 'R8913:Mroh2b'

700849

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R8913 (G1)

Quality Score

195.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 4917528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably benign
Transcript: ENSMUST00000045736

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

96% (65/68)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,264,813	Y2102H	probably damaging	Het
Adam30	A	T	3: 98,161,264	I10F	possibly damaging	Het
Afap1l1	C	T	18: 61,756,839		probably null	Het
Asz1	T	C	6: 18,054,571	D411G	probably benign	Het
Atp8b2	A	G	3: 89,945,523	L144P		Het
Atxn7l3	G	T	11: 102,294,961	N13K	probably damaging	Het
Cap1	C	A	4: 122,867,652		probably null	Het
Cd244	T	A	1: 171,574,206	Y167N	probably damaging	Het
Cd244	A	T	1: 171,574,207	Y167F	probably damaging	Het
Cd302	A	G	2: 60,257,897	F92S	probably damaging	Het
Cep128	C	T	12: 91,364,447		probably null	Het
Csmd2	C	A	4: 128,523,558	P2770T		Het
Cyp4f40	G	T	17: 32,667,836	D122Y	probably benign	Het
Dnah14	A	G	1: 181,725,498	E2583G	probably benign	Het
Dync1h1	T	C	12: 110,658,168	V3714A	probably benign	Het
Fam114a1	G	T	5: 65,028,478	A381S	possibly damaging	Het
Fam208a	A	T	14: 27,466,188	N864Y	probably damaging	Het
Fzd8	A	G	18: 9,213,869	Y317C	probably damaging	Het
Igfn1	T	C	1: 135,963,841	K2312R	possibly damaging	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Klhl23	G	A	2: 69,833,890	E528K	probably damaging	Het
Lama4	T	C	10: 39,106,043	V1756A	probably benign	Het
Lcn2	C	A	2: 32,387,146	V53F	possibly damaging	Het
Lrp4	T	C	2: 91,501,440	S1633P	probably benign	Het
Map3k19	A	G	1: 127,822,626	V996A	probably benign	Het
Mettl9	T	G	7: 121,076,316	F313C	probably damaging	Het
Mios	T	A	6: 8,215,924	H373Q	probably benign	Het
Myo1a	T	C	10: 127,705,841	V83A	probably benign	Het
Naxe	T	C	3: 88,058,358	T45A	probably benign	Het
Nckap1	A	G	2: 80,571,220	V40A	possibly damaging	Het
Nmt1	G	T	11: 103,057,445	R265L	probably damaging	Het
Nwd2	C	A	5: 63,806,097	A1008D	possibly damaging	Het
Obsl1	C	T	1: 75,491,248	A1334T	probably benign	Het
Olfr1209	A	G	2: 88,909,647	F249L	probably benign	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Olfr1361	A	G	13: 21,659,104	F73S	probably damaging	Het
Olfr517	A	T	7: 108,868,602	V184E	probably damaging	Het
Olfr519	T	C	7: 108,893,529	R298G	probably damaging	Het
Oplah	T	C	15: 76,297,480	M1114V		Het
Pdlim5	A	T	3: 142,244,905	F582L	probably damaging	Het
Plcb2	A	G	2: 118,713,884	F671L	probably damaging	Het
Ppfibp1	T	A	6: 147,022,449	V725E	probably damaging	Het
Psmd11	C	T	11: 80,471,512	T396I	probably damaging	Het
Ptn	C	T	6: 36,741,341	D130N	probably benign	Het
Rasgrf2	T	C	13: 92,022,526	D473G	probably benign	Het
Robo1	A	C	16: 72,904,734	I163L	probably damaging	Het
Ror1	A	C	4: 100,407,830	D167A	possibly damaging	Het
Rps6ka5	T	C	12: 100,554,336	D709G		Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Runx2	T	C	17: 44,608,282	T472A	probably benign	Het
Scn11a	T	C	9: 119,794,028	T582A	probably damaging	Het
Serpina3m	C	T	12: 104,389,218	A48V	probably benign	Het
Slc9a3r2	G	A	17: 24,644,865	S12L	probably benign	Het
Smim8	T	A	4: 34,769,056	D76V	possibly damaging	Het
Sqor	A	G	2: 122,799,886	K260R	probably benign	Het
Syde2	A	T	3: 146,002,393	I963F	probably damaging	Het
Tenm4	G	A	7: 96,702,745		probably benign	Het
Tm7sf3	A	T	6: 146,626,123	Y68*	probably null	Het
Tmtc2	T	A	10: 105,323,026	I569F	probably damaging	Het
Upf3a	G	A	8: 13,795,728	V276M	possibly damaging	Het
Vmn1r174	G	A	7: 23,753,950	V14M	possibly damaging	Het
Vmn2r104	A	G	17: 20,029,706	S768P	probably damaging	Het
Vmn2r60	A	T	7: 42,136,354	T194S	probably benign	Het
Zfhx2	A	G	14: 55,072,086	M852T	probably benign	Het
Zfp207	T	A	11: 80,385,918	D19E	probably damaging	Het
Zfp318	G	A	17: 46,411,773	M1567I	probably benign	Het
Zfp407	T	A	18: 84,560,528	E820V	probably damaging	Het
Zfp512b	A	T	2: 181,585,489	C46S		Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTGAATTTTCCCCGGGC -3'
(R):5'- TACGCATGAGATTCTGTACACG -3'

Sequencing Primer
(F):5'- CCCTGCGGTGATGGTGAAAATTAC -3'
(R):5'- TAGGTCTGAACCTGCATC -3'

Posted On

2022-02-10