Incidental Mutation 'R0761:Csgalnact2'
ID70087
Institutional Source Beutler Lab
Gene Symbol Csgalnact2
Ensembl Gene ENSMUSG00000042042
Gene Namechondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms4632415D10Rik, Galnact2
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118107452-118139140 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 118126112 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049344] [ENSMUST00000136265]
Predicted Effect probably benign
Transcript: ENSMUST00000049344
SMART Domains Protein: ENSMUSP00000039819
Gene: ENSMUSG00000042042

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:CHGN 53 516 3e-83 PFAM
Pfam:Glyco_tranf_2_2 273 477 4.1e-8 PFAM
Pfam:Glyco_transf_7C 413 489 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125531
Predicted Effect probably benign
Transcript: ENSMUST00000136265
SMART Domains Protein: ENSMUSP00000116371
Gene: ENSMUSG00000042042

DomainStartEndE-ValueType
Pfam:CHGN 2 223 5.8e-45 PFAM
Pfam:Glyco_tranf_2_2 31 223 6.5e-9 PFAM
Pfam:Glyco_transf_7C 170 223 1.2e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. The encoded protein is involved in elongation during chondroitin sulfate synthesis. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome X. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Csgalnact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Csgalnact2 APN 6 118126272 start codon destroyed probably null 0.88
IGL00955:Csgalnact2 APN 6 118129264 missense probably damaging 1.00
IGL01396:Csgalnact2 APN 6 118126327 missense probably damaging 1.00
IGL01757:Csgalnact2 APN 6 118129346 missense probably damaging 1.00
IGL02687:Csgalnact2 APN 6 118124415 critical splice acceptor site probably null
IGL02833:Csgalnact2 APN 6 118129268 missense probably damaging 1.00
IGL02837:Csgalnact2 UTSW 6 118124403 missense probably benign 0.10
R0206:Csgalnact2 UTSW 6 118114386 missense probably benign 0.13
R1201:Csgalnact2 UTSW 6 118114432 missense probably damaging 0.98
R2106:Csgalnact2 UTSW 6 118109129 nonsense probably null
R3773:Csgalnact2 UTSW 6 118126219 missense probably benign 0.17
R3900:Csgalnact2 UTSW 6 118121014 missense probably damaging 1.00
R5618:Csgalnact2 UTSW 6 118126316 missense probably damaging 0.99
R5682:Csgalnact2 UTSW 6 118120992 missense probably damaging 1.00
R5744:Csgalnact2 UTSW 6 118126236 missense probably damaging 1.00
R5895:Csgalnact2 UTSW 6 118129254 nonsense probably null
R7819:Csgalnact2 UTSW 6 118121089 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GAGTCTCCAAGTAGTTGTCACCTCAGA -3'
(R):5'- GGCTGTACATAGGGGTAGGTATTTCCA -3'

Sequencing Primer
(F):5'- TGCAGCATACATGCTTTGAG -3'
(R):5'- ATCCTTGCCTGAGTGAAATCTG -3'
Posted On2013-09-30