Mutagenetix > Incidental Mutation

Incidental Mutation 'R8905:Celsr1'

700888

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

MMRRC Submission

068762-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.686) question?

Stock #

R8905 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 85904068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000016172

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226204

Predicted Effect

probably benign
Transcript: ENSMUST00000226840

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	C	4: 137,455,242	V236A	probably benign	Het
4931408C20Rik	A	G	1: 26,682,814	V1095A	probably damaging	Het
Abca15	A	T	7: 120,361,548	R744S	probably benign	Het
Adgra1	T	C	7: 139,875,847	S464P	probably damaging	Het
Arhgap45	T	C	10: 80,019,736	V3A	probably benign	Het
AW554918	T	A	18: 25,340,149	S134T	probably damaging	Het
Bmper	A	G	9: 23,406,786	E567G	probably benign	Het
C2cd3	T	C	7: 100,424,925		probably null	Het
Cars	A	G	7: 143,586,459	Y170H	probably damaging	Het
Ccdc173	A	G	2: 69,781,760	S175P	probably benign	Het
Celsr3	C	T	9: 108,841,302	H2351Y	probably damaging	Het
Cyp2d11	T	C	15: 82,390,901	I282V	probably benign	Het
Dhfr	A	G	13: 92,357,959	T57A	probably damaging	Het
Dnah7b	A	C	1: 46,253,374	Q2973P	probably damaging	Het
Dnajc5b	T	C	3: 19,579,020	C136R	probably benign	Het
Efcab1	A	G	16: 14,920,411	I147V	possibly damaging	Het
Ercc3	T	G	18: 32,265,718	D683E	possibly damaging	Het
Faxc	A	G	4: 21,982,398	Y279C	probably damaging	Het
Fbxw7	T	C	3: 84,965,327	M191T	possibly damaging	Het
Fcgbp	T	A	7: 28,086,509	V457E	probably damaging	Het
Fip1l1	A	T	5: 74,595,963	T539S	probably damaging	Het
Gabra1	T	C	11: 42,147,225	T189A	possibly damaging	Het
Glg1	T	C	8: 111,158,036	D1118G	probably damaging	Het
Gli3	A	G	13: 15,726,531	D1501G	probably benign	Het
Gm4756	T	A	12: 72,619,657	D80V	probably damaging	Het
Hacd1	A	G	2: 14,044,950	I91T	possibly damaging	Het
Ift22	T	C	5: 136,912,891	V159A	probably benign	Het
Igkv1-110	T	A	6: 68,271,086	Y60N	probably damaging	Het
Inpp5d	A	G	1: 87,709,626	K502E	probably damaging	Het
Kcnt2	A	T	1: 140,507,729	Q478L	possibly damaging	Het
Mettl13	A	G	1: 162,537,278	F511L	probably damaging	Het
Mis18bp1	T	C	12: 65,133,627		probably null	Het
Mrps30	A	T	13: 118,386,943	S98T	probably benign	Het
Muc2	C	T	7: 141,693,400	A209V	probably benign	Het
Nfs1	A	T	2: 156,128,583	I270N	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nsmaf	A	G	4: 6,424,951	S266P	probably benign	Het
Obscn	A	G	11: 59,069,958	S3176P	probably damaging	Het
Olfr1230	A	T	2: 89,296,457	L271Q	possibly damaging	Het
Olfr834	A	G	9: 18,988,198	D70G	possibly damaging	Het
P2ry12	T	A	3: 59,217,576	Y226F	probably damaging	Het
Pabpc2	C	A	18: 39,774,651	T323K	probably benign	Het
Pank2	A	G	2: 131,282,726	D71G	possibly damaging	Het
Patj	A	T	4: 98,497,175	H393L	probably damaging	Het
Pde8b	A	G	13: 95,046,485	V255A	probably damaging	Het
Plekhs1	T	C	19: 56,482,596	W374R	probably damaging	Het
Ppm1g	T	C	5: 31,204,093	D313G	probably damaging	Het
Rnf114	A	G	2: 167,511,214	N135S	probably benign	Het
Rnf43	T	G	11: 87,731,125	Y351D	probably damaging	Het
Robo1	A	T	16: 72,742,285	D90V	probably damaging	Het
Sbds	A	G	5: 130,248,284	V172A	possibly damaging	Het
Scamp5	T	A	9: 57,445,386	I167F	probably benign	Het
Sec14l5	A	G	16: 5,176,500	E386G	probably damaging	Het
Sfxn1	T	A	13: 54,092,414	V159E	probably damaging	Het
Sgsm1	C	T	5: 113,273,629	G531R	probably benign	Het
Slc22a26	T	A	19: 7,782,966	I471F	probably damaging	Het
Slc41a3	T	A	6: 90,612,141	M78K	probably benign	Het
Slc8a1	A	T	17: 81,441,655	Y653N	probably benign	Het
Slco6c1	A	T	1: 97,125,666	M170K	possibly damaging	Het
Smarca5	A	T	8: 80,713,948	I629K	probably benign	Het
Smg7	T	A	1: 152,840,066	D1099V	probably damaging	Het
Srbd1	T	C	17: 86,001,462	I763V	probably benign	Het
Stk25	A	G	1: 93,629,207	S30P	probably damaging	Het
Sv2b	C	T	7: 75,117,711	A646T	probably benign	Het
Tardbp	T	C	4: 148,620,636	M167V	probably benign	Het
Tmem132a	T	C	19: 10,865,283	N276S	probably damaging	Het
Ttpa	T	A	4: 20,028,435	S162T	probably benign	Het
Usp13	T	C	3: 32,881,423	Y333H	probably damaging	Het
Vmn2r3	T	A	3: 64,259,274	Y812F	probably damaging	Het
Yeats2	A	G	16: 20,190,394	T463A	probably benign	Het
Zbtb26	T	A	2: 37,436,915	K36N	probably benign	Het
Zfc3h1	A	T	10: 115,423,478	T1652S	probably benign	Het
Zfp472	G	A	17: 32,978,481	C510Y	possibly damaging	Het
Zfp518a	C	A	19: 40,914,336	T903K	probably damaging	Het
Zfp668	T	C	7: 127,866,426	T529A	probably benign	Het
Zfp930	A	G	8: 69,228,699	T349A	possibly damaging	Het
Zmiz2	T	G	11: 6,396,840	Y182D	probably damaging	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85929419	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85963223	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	86031967	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85931282	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85919038	splice site	probably null
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
R8771:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85937993	missense	probably benign	0.01
R8924:Celsr1	UTSW	15	86032470	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85963139	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	86030571	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85919016	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	86033085	nonsense	probably null
R9196:Celsr1	UTSW	15	86033085	nonsense	probably null
R9198:Celsr1	UTSW	15	86033085	nonsense	probably null
R9200:Celsr1	UTSW	15	86033085	nonsense	probably null
R9201:Celsr1	UTSW	15	86033085	nonsense	probably null
R9202:Celsr1	UTSW	15	86033085	nonsense	probably null
R9203:Celsr1	UTSW	15	86033085	nonsense	probably null
R9222:Celsr1	UTSW	15	85931270	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	86030850	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	86033085	nonsense	probably null
R9386:Celsr1	UTSW	15	85979030	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	86033085	nonsense	probably null
R9401:Celsr1	UTSW	15	86033085	nonsense	probably null
R9415:Celsr1	UTSW	15	86033085	nonsense	probably null
R9428:Celsr1	UTSW	15	85931348	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85922334	splice site	probably benign
R9493:Celsr1	UTSW	15	85901145	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	86033085	nonsense	probably null
R9499:Celsr1	UTSW	15	86033085	nonsense	probably null
R9607:Celsr1	UTSW	15	86031028	missense
R9673:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAACAGGCGACTCTGTC -3'
(R):5'- TACAATAAGGCATTGCAAGCTG -3'

Sequencing Primer
(F):5'- TCCTGGCACCTACCTGCAAG -3'
(R):5'- TGGCCTCGAACTCAGAGATC -3'

Posted On

2022-02-28