Incidental Mutation 'R8953:Mertk'
ID 700896
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Name c-mer proto-oncogene tyrosine kinase
Synonyms Nyk, nmf12, Tyro 12, Eyk, Mer
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8953 (G1)
Quality Score 101.008
Status Validated
Chromosome 2
Chromosomal Location 128698956-128802894 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 128778796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
AlphaFold Q60805
Predicted Effect probably benign
Transcript: ENSMUST00000014505
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
Abca17 C A 17: 24,299,041 V765L probably benign Het
Atp2b2 T A 6: 113,760,669 T915S possibly damaging Het
BC017158 T G 7: 128,273,506 Q423H probably benign Het
Cacna1s C T 1: 136,097,432 H992Y possibly damaging Het
Clpp T A 17: 56,991,373 M113K probably damaging Het
Csn3 A G 5: 87,929,950 Q105R possibly damaging Het
Dcaf1 G A 9: 106,858,343 R830Q possibly damaging Het
Dnah17 A T 11: 118,125,412 probably benign Het
Etv4 A G 11: 101,771,687 probably null Het
Fos A G 12: 85,476,052 D246G probably benign Het
Foxo1 T C 3: 52,346,254 S613P probably damaging Het
Gabra2 A T 5: 71,006,182 C261S probably damaging Het
Garem1 A T 18: 21,131,331 probably null Het
Gatsl3 A T 11: 4,221,249 I244F probably benign Het
Gm10436 A G 12: 88,177,300 C248R probably benign Het
Gmip T G 8: 69,816,777 L533R probably damaging Het
Gpr1 A G 1: 63,183,113 L321P probably damaging Het
Havcr1 A G 11: 46,756,179 T147A possibly damaging Het
Helz2 C T 2: 181,233,091 R1870Q probably damaging Het
Kcnk3 A C 5: 30,622,038 K144T probably damaging Het
Lama5 A G 2: 180,193,520 V1293A probably damaging Het
Man2b1 A G 8: 85,091,910 I498V probably benign Het
Map6 T C 7: 99,315,871 L289P probably damaging Het
Mapk7 G T 11: 61,492,966 D43E possibly damaging Het
Medag A G 5: 149,427,300 Y194C probably damaging Het
Mier3 C A 13: 111,706,053 T136K probably benign Het
Ndc1 T A 4: 107,381,693 W242R probably damaging Het
Nlrp1b A G 11: 71,161,806 V932A probably damaging Het
Olfr1138 A T 2: 87,738,027 M99K probably benign Het
Olfr164 T A 16: 19,286,519 M75L probably benign Het
Olfr460 G T 6: 40,571,742 A119S possibly damaging Het
Olfr476 G A 7: 107,968,044 V216I probably benign Het
Otub2 A T 12: 103,404,326 D289V probably damaging Het
P2rx3 A G 2: 85,023,498 V133A possibly damaging Het
Pde4a C A 9: 21,210,734 T585K probably damaging Het
Pik3c2a A T 7: 116,388,085 Y534N probably benign Het
Pip5kl1 A G 2: 32,579,979 D232G possibly damaging Het
Pklr C T 3: 89,142,305 S234L probably damaging Het
Pkn1 T C 8: 83,684,186 K271E probably damaging Het
Plch1 T G 3: 63,731,705 H449P possibly damaging Het
Pparg T C 6: 115,441,546 L92P possibly damaging Het
Ptgdr2 C T 19: 10,940,422 T101I probably benign Het
Rad54l2 A T 9: 106,693,262 H1286Q probably benign Het
Ralgapa1 A G 12: 55,820,761 S3P probably damaging Het
Rictor G A 15: 6,794,447 V1598I probably benign Het
Rph3al G T 11: 75,906,575 C98* probably null Het
Rpn2 A G 2: 157,321,826 T613A probably damaging Het
Rps20 T A 4: 3,834,617 M82L probably benign Het
Sh3bp4 A G 1: 89,144,437 I336V probably damaging Het
Slc6a20b T C 9: 123,609,189 N174S probably damaging Het
Spta1 A G 1: 174,230,675 N1903S probably benign Het
Ssfa2 T C 2: 79,660,495 Y986H probably damaging Het
Tacc2 T C 7: 130,625,757 S1391P probably benign Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Trhde T A 10: 114,503,061 I615F probably damaging Het
Ttc13 T C 8: 124,675,349 N556S probably damaging Het
Ttn T A 2: 76,737,884 D19228V probably damaging Het
Unc13c T A 9: 73,932,762 Y269F probably benign Het
Usp33 T A 3: 152,374,783 V517E possibly damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Zfp318 T A 17: 46,420,430 S1120T probably benign Het
Zfr2 C A 10: 81,248,437 N650K probably damaging Het
Znfx1 G A 2: 167,055,501 T501I probably damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
R9135:Mertk UTSW 2 128762115 missense probably benign 0.23
R9153:Mertk UTSW 2 128782567 missense probably damaging 1.00
R9176:Mertk UTSW 2 128778972 missense possibly damaging 0.62
R9443:Mertk UTSW 2 128762109 missense probably benign 0.00
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAATCCACCAGCATGTGC -3'
(R):5'- ACCTTCACCCAGAACTTTGC -3'

Sequencing Primer
(F):5'- ATGTGCTCATTGGTGTTTCCCTAAC -3'
(R):5'- CTTTGCCGAGAACCAGAAGG -3'
Posted On 2022-03-03