Incidental Mutation 'R8872:Sec24d'
ID 700901
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8872 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 123354936 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably benign
Transcript: ENSMUST00000047923
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,644 S150G possibly damaging Het
4932415D10Rik A T 10: 82,292,785 S1464T probably benign Het
Alpk2 A T 18: 65,280,906 S1579R probably damaging Het
Ank2 C T 3: 126,997,876 E814K possibly damaging Het
Cep57 A G 9: 13,826,684 probably benign Het
Cntnap4 A T 8: 112,859,127 R1127S possibly damaging Het
Comt C A 16: 18,426,489 probably benign Het
Crlf3 T C 11: 80,047,614 N399S Het
Crls1 T A 2: 132,849,899 S115T probably benign Het
Dixdc1 A G 9: 50,703,153 S199P possibly damaging Het
Dsc3 T C 18: 19,989,622 T82A probably benign Het
Exosc6 T A 8: 111,057,152 V261E probably damaging Het
Fbxw17 C T 13: 50,432,264 S361L probably benign Het
Gfap T A 11: 102,895,794 N157Y possibly damaging Het
Gigyf2 A T 1: 87,380,003 D177V unknown Het
Gls2 A T 10: 128,204,666 Q312L probably benign Het
Gm11639 T G 11: 104,870,054 L2411R probably benign Het
Gm8909 T A 17: 36,165,401 I324F probably benign Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l A T 18: 10,529,684 M889L probably benign Het
Gucy1a1 T A 3: 82,108,742 D313V probably damaging Het
Herpud1 C T 8: 94,386,585 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il27 A C 7: 126,591,022 L140R probably damaging Het
Jarid2 T C 13: 44,902,508 S397P possibly damaging Het
Kdm5a A C 6: 120,388,140 D334A probably damaging Het
Lman2 T C 13: 55,348,384 T283A probably benign Het
Lrfn2 C T 17: 49,071,249 Q453* probably null Het
Lrrfip2 A G 9: 111,205,756 E171G possibly damaging Het
Mboat1 T A 13: 30,226,414 Y285N probably damaging Het
Med15 C A 16: 17,652,741 S734I probably damaging Het
Mgat4c T A 10: 102,388,285 I120N probably damaging Het
Ms4a4d T C 19: 11,552,887 M104T possibly damaging Het
Mtf2 A T 5: 108,099,185 M330L probably benign Het
Myoc T C 1: 162,647,444 V188A probably benign Het
Nos2 T A 11: 78,949,123 I686N probably damaging Het
Npffr1 T C 10: 61,626,015 V310A probably benign Het
Nrap T C 19: 56,320,195 *1729W probably null Het
Odam A G 5: 87,887,938 probably null Het
Olfm4 G T 14: 80,021,503 R397L probably damaging Het
Olfr406 T G 11: 74,269,294 probably benign Het
Polr1b T C 2: 129,115,693 V556A probably damaging Het
Prl3d3 A G 13: 27,162,341 D186G possibly damaging Het
Psmc5 C A 11: 106,261,920 Y189* probably null Het
Rasgrp4 A G 7: 29,139,096 Y123C possibly damaging Het
Rtn4 A G 11: 29,708,633 E929G probably benign Het
Scrn2 A T 11: 97,032,135 I135F probably damaging Het
Secisbp2l T C 2: 125,752,972 T523A probably benign Het
Slain1 T A 14: 103,688,405 probably null Het
Slc22a29 A G 19: 8,160,567 V548A probably damaging Het
Slc25a32 T C 15: 39,105,944 I65V probably benign Het
Slc30a7 A T 3: 115,946,668 M378K possibly damaging Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Spdye4b G T 5: 143,202,060 K156N probably damaging Het
Sptb A G 12: 76,612,039 Y1241H probably benign Het
Ssu2 G A 6: 112,380,995 T129I probably damaging Het
Supt16 A G 14: 52,174,087 V613A probably benign Het
Sycp3 A T 10: 88,466,526 E126V probably damaging Het
Tatdn2 A T 6: 113,704,209 Y401F probably damaging Het
Tigd4 T C 3: 84,594,240 S155P probably benign Het
Tnrc6b A G 15: 80,918,089 N1502S probably benign Het
Ttc37 T C 13: 76,185,207 L1525P probably damaging Het
Ttf2 A G 3: 100,963,328 V143A probably benign Het
Ttn T A 2: 76,788,403 D16179V probably damaging Het
Vmn2r106 A T 17: 20,268,139 M666K probably benign Het
Vwa5b1 A T 4: 138,578,645 V914D probably damaging Het
Wnk2 T C 13: 49,057,484 M1632V probably benign Het
Zbtb26 T A 2: 37,436,901 N41I probably damaging Het
Zc3h12a T C 4: 125,126,619 N144D probably damaging Het
Zfp266 A T 9: 20,499,979 C301S probably benign Het
Zfp580 A G 7: 5,053,217 H192R possibly damaging Het
Zfp748 A G 13: 67,541,795 C449R probably damaging Het
Zp2 T C 7: 120,133,802 I612V probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
R9447:Sec24d UTSW 3 123290513 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTTGATCGCTTAAACCATTG -3'
(R):5'- GCTACCCAATGAGTCTCAGCTG -3'

Sequencing Primer
(F):5'- GCTTAAACCATTGAAATGTTACAGCG -3'
(R):5'- CTGACTCACCGAGCTATGAGATTAG -3'
Posted On 2022-03-03