Incidental Mutation 'R0761:Mfap3l'
ID70091
Institutional Source Beutler Lab
Gene Symbol Mfap3l
Ensembl Gene ENSMUSG00000031647
Gene Namemicrofibrillar-associated protein 3-like
Synonyms5430405D20Rik, NYD-sp9, 4933428A15Rik
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60632827-60676729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60671581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 286 (V286L)
Ref Sequence ENSEMBL: ENSMUSP00000124330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034066] [ENSMUST00000160719] [ENSMUST00000161421] [ENSMUST00000161702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034066
AA Change: V286L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034066
Gene: ENSMUSG00000031647
AA Change: V286L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 59 132 5.65e-12 SMART
transmembrane domain 150 172 N/A INTRINSIC
low complexity region 343 374 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160719
AA Change: V286L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125139
Gene: ENSMUSG00000031647
AA Change: V286L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 59 132 5.65e-12 SMART
transmembrane domain 150 172 N/A INTRINSIC
low complexity region 343 374 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161421
AA Change: V183L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124136
Gene: ENSMUSG00000031647
AA Change: V183L

DomainStartEndE-ValueType
SCOP:d1biha4 1 39 1e-9 SMART
Blast:IG 1 40 1e-18 BLAST
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 240 271 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161702
AA Change: V286L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124330
Gene: ENSMUSG00000031647
AA Change: V286L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 59 132 5.65e-12 SMART
transmembrane domain 150 172 N/A INTRINSIC
low complexity region 343 374 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Mfap3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Mfap3l APN 8 60671909 missense probably benign 0.28
IGL00958:Mfap3l APN 8 60671482 missense probably benign 0.00
IGL01995:Mfap3l APN 8 60671464 missense possibly damaging 0.59
R1888:Mfap3l UTSW 8 60671390 missense possibly damaging 0.94
R1888:Mfap3l UTSW 8 60671390 missense possibly damaging 0.94
R4646:Mfap3l UTSW 8 60671150 missense probably damaging 1.00
R5286:Mfap3l UTSW 8 60656869 missense probably benign 0.19
R5637:Mfap3l UTSW 8 60656787 missense probably damaging 0.98
R6216:Mfap3l UTSW 8 60671807 missense probably damaging 0.97
R7124:Mfap3l UTSW 8 60671269 missense probably damaging 0.97
R7597:Mfap3l UTSW 8 60671281 missense possibly damaging 0.95
R8745:Mfap3l UTSW 8 60671924 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGAGATTGCTAAACGCATCCCCATC -3'
(R):5'- TGTCACATGTCACTGCTGGCTC -3'

Sequencing Primer
(F):5'- ACTTGCCAAAGTGACTCAGTTC -3'
(R):5'- TCTGGTGCCTCTACAGGAGAC -3'
Posted On2013-09-30