Incidental Mutation 'R8923:Ercc1'
ID 700912
Institutional Source Beutler Lab
Gene Symbol Ercc1
Ensembl Gene ENSMUSG00000003549
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 1
Synonyms Ercc-1
MMRRC Submission 068768-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8923 (G1)
Quality Score 135.008
Status Validated
Chromosome 7
Chromosomal Location 19079016-19090449 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 19081062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000160369] [ENSMUST00000161378] [ENSMUST00000176818]
AlphaFold P07903
Predicted Effect probably benign
Transcript: ENSMUST00000003645
SMART Domains Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 100 213 2.9e-55 PFAM
HhH1 269 288 4.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160369
SMART Domains Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 99 166 1.6e-34 PFAM
low complexity region 232 245 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161378
AA Change: W54R
Predicted Effect probably benign
Transcript: ENSMUST00000176818
SMART Domains Protein: ENSMUSP00000135767
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
Pfam:Rad10 23 90 8.4e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
PHENOTYPE: Nullizygous mutations result in growth and liver failure, nuclear anomalies and postnatal death, and may lead to spleen hypoplasia, altered isotype switching, B cell hypoproliferation, dystonia, ataxia, renal failure, sarcopenia, kyphosis, early replicative aging and sensitivity to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,204,288 (GRCm39) Y308H possibly damaging Het
Ano6 T C 15: 95,811,428 (GRCm39) I176T probably damaging Het
Ap3b2 T C 7: 81,126,931 (GRCm39) E273G probably benign Het
Arid1a A G 4: 133,412,304 (GRCm39) I1245T unknown Het
Ash1l T C 3: 88,892,974 (GRCm39) S1618P possibly damaging Het
Atp5f1e G T 2: 174,304,309 (GRCm39) S49* probably null Het
Bsdc1 C T 4: 129,355,405 (GRCm39) probably benign Het
Ccni T C 5: 93,335,943 (GRCm39) H152R probably damaging Het
Cdk5 A G 5: 24,625,284 (GRCm39) V208A possibly damaging Het
Cmtm5 G A 14: 55,176,345 (GRCm39) D137N probably damaging Het
Cyp3a41b A G 5: 145,521,448 (GRCm39) M1T probably null Het
Cyp3a44 A T 5: 145,736,171 (GRCm39) V93E probably damaging Het
Dhrs2 A T 14: 55,478,309 (GRCm39) I241F probably benign Het
Dip2c A G 13: 9,673,901 (GRCm39) T1114A probably damaging Het
Dsel T C 1: 111,788,284 (GRCm39) I750M possibly damaging Het
Dync2h1 T C 9: 7,168,515 (GRCm39) K398E probably benign Het
Efcab12 G C 6: 115,787,982 (GRCm39) T660S possibly damaging Het
Ep400 A G 5: 110,831,864 (GRCm39) L2126P unknown Het
Flnc G T 6: 29,452,236 (GRCm39) D1687Y probably damaging Het
Frrs1 A T 3: 116,696,070 (GRCm39) I530F possibly damaging Het
Gp5 G T 16: 30,128,222 (GRCm39) L151I probably damaging Het
H2-Q5 A G 17: 35,613,982 (GRCm39) D177G Het
Itgal A T 7: 126,895,533 (GRCm39) probably benign Het
Klhl33 A T 14: 51,129,882 (GRCm39) C277* probably null Het
Lefty1 T A 1: 180,765,318 (GRCm39) C295* probably null Het
Lmo7 A T 14: 102,137,679 (GRCm39) T794S probably benign Het
Mss51 A G 14: 20,537,177 (GRCm39) M97T possibly damaging Het
Mtmr11 C T 3: 96,072,188 (GRCm39) P262S probably damaging Het
Muc15 A T 2: 110,562,212 (GRCm39) N216I probably damaging Het
Muc16 A T 9: 18,549,972 (GRCm39) D5440E probably benign Het
Myt1l A G 12: 29,960,800 (GRCm39) K1038E unknown Het
Naa15 G A 3: 51,367,443 (GRCm39) V539M probably damaging Het
Or10al2 A T 17: 37,983,702 (GRCm39) I263F probably benign Het
Or1e26 T C 11: 73,480,076 (GRCm39) I163V probably benign Het
Or5ac20 G C 16: 59,104,399 (GRCm39) L154V probably benign Het
Parpbp C T 10: 87,947,474 (GRCm39) V387I probably benign Het
Pbxip1 T C 3: 89,352,921 (GRCm39) I189T possibly damaging Het
Prkci T A 3: 31,095,250 (GRCm39) Y111* probably null Het
Prkd2 C G 7: 16,599,682 (GRCm39) T715R probably damaging Het
Rab40c A C 17: 26,102,664 (GRCm39) S262A probably benign Het
Rad51d A G 11: 82,773,798 (GRCm39) L164P probably damaging Het
Rgs22 T A 15: 36,093,106 (GRCm39) K513I probably damaging Het
Rubcn G T 16: 32,646,049 (GRCm39) T828K probably damaging Het
Sdha G A 13: 74,487,179 (GRCm39) T203M probably damaging Het
Sesn3 T C 9: 14,217,562 (GRCm39) probably null Het
Spag8 T A 4: 43,651,471 (GRCm39) T468S probably damaging Het
Spdl1 T C 11: 34,704,478 (GRCm39) K452E possibly damaging Het
Stat5a T C 11: 100,771,308 (GRCm39) F597S Het
Sult1b1 A C 5: 87,662,893 (GRCm39) F269C probably damaging Het
Ubap1 A G 4: 41,379,170 (GRCm39) N128S probably benign Het
Utp20 G A 10: 88,627,604 (GRCm39) Q954* probably null Het
Vmn1r173 T A 7: 23,401,768 (GRCm39) M1K probably null Het
Wdfy1 A G 1: 79,684,017 (GRCm39) S373P probably benign Het
Other mutations in Ercc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Ercc1 APN 7 19,089,288 (GRCm39) critical splice donor site probably null
joyless UTSW 7 19,089,102 (GRCm39) splice site probably null
R2062:Ercc1 UTSW 7 19,088,295 (GRCm39) makesense probably null
R4373:Ercc1 UTSW 7 19,081,057 (GRCm39) unclassified probably benign
R4374:Ercc1 UTSW 7 19,081,057 (GRCm39) unclassified probably benign
R4375:Ercc1 UTSW 7 19,081,057 (GRCm39) unclassified probably benign
R4852:Ercc1 UTSW 7 19,084,629 (GRCm39) missense probably damaging 1.00
R6000:Ercc1 UTSW 7 19,081,086 (GRCm39) unclassified probably benign
R6415:Ercc1 UTSW 7 19,089,102 (GRCm39) splice site probably null
R8113:Ercc1 UTSW 7 19,084,102 (GRCm39) missense probably damaging 1.00
R8369:Ercc1 UTSW 7 19,088,377 (GRCm39) nonsense probably null
R8557:Ercc1 UTSW 7 19,082,480 (GRCm39) missense probably benign 0.00
R9566:Ercc1 UTSW 7 19,088,377 (GRCm39) nonsense probably null
X0057:Ercc1 UTSW 7 19,090,374 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGGCTCTGGATTTGAC -3'
(R):5'- AAGCCATCTCTTCAGCCCTG -3'

Sequencing Primer
(F):5'- CTTCCCAAGTGCTAGGATCAAAGG -3'
(R):5'- GCCCTGGCTCATATATTTAATGC -3'
Posted On 2022-03-10