Mutagenetix > Incidental Mutation

Incidental Mutation 'R8930:Mast3'

700913

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 70781733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211948

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (64/64)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,742,201	E184K	possibly damaging	Het
4921524L21Rik	T	C	18: 6,629,693		probably null	Het
Abl2	A	G	1: 156,633,832	T435A	probably damaging	Het
Adamtsl3	C	T	7: 82,611,861	P29S		Het
Ankrd11	C	T	8: 122,895,979	R378K	probably damaging	Het
Arap1	G	A	7: 101,408,117	R1355Q	possibly damaging	Het
Ass1	T	A	2: 31,492,375	M186K	probably damaging	Het
Bckdk	A	G	7: 127,908,010	D312G	probably benign	Het
Btg3	T	A	16: 78,373,410	N3I	probably benign	Het
C87414	T	G	5: 93,638,085	D112A	probably benign	Het
Cd163	T	C	6: 124,317,923	F649L	probably damaging	Het
Cdh1	ACTCGAAATGATGTGGCTC	ACTC	8: 106,666,238		probably benign	Het
Cnksr3	A	T	10: 7,160,780	V27E	probably damaging	Het
Col12a1	A	T	9: 79,673,383	S1512T	probably benign	Het
Cstf1	A	G	2: 172,375,703	T79A	probably benign	Het
Defa24	T	C	8: 21,735,357	Y88H	probably benign	Het
Dgkz	C	T	2: 91,939,570	R389Q	probably damaging	Het
Dsg3	T	A	18: 20,539,661	D796E	probably damaging	Het
Dyrk3	G	T	1: 131,129,556	D293E	probably damaging	Het
Epb42	T	C	2: 121,024,286	D606G	probably benign	Het
Erich5	G	A	15: 34,453,698	G18S	probably benign	Het
Fam196a	A	G	7: 134,899,152	I408T	probably damaging	Het
Fam196b	T	C	11: 34,402,707	S250P	probably benign	Het
Fam8a1	C	T	13: 46,674,392	T352M	probably benign	Het
Fastkd3	T	A	13: 68,583,716	L52Q	probably benign	Het
Fat3	G	A	9: 15,999,523	H1728Y	probably benign	Het
Fgl1	A	G	8: 41,209,831	V39A	probably benign	Het
Gm7298	T	C	6: 121,765,071	V484A	probably benign	Het
Gpr75	A	G	11: 30,892,571	Q492R	possibly damaging	Het
Hoxc8	A	G	15: 102,990,886	H36R	possibly damaging	Het
Isy1	T	C	6: 87,821,531	I214V	probably damaging	Het
Kdm5b	C	T	1: 134,616,272	P853L	probably damaging	Het
Man2b1	A	G	8: 85,095,393	T746A	probably damaging	Het
Mki67	A	G	7: 135,698,899	S1469P	possibly damaging	Het
Mrps30	C	T	13: 118,387,159	A26T	probably benign	Het
Mup10	T	A	4: 60,580,709	T92S	possibly damaging	Het
Otud7a	A	G	7: 63,757,491	D514G	possibly damaging	Het
Pacs1	T	A	19: 5,135,002	S932C	probably damaging	Het
Pbx2	C	T	17: 34,594,589	R188C	probably damaging	Het
Pclo	C	T	5: 14,712,975	P536S	possibly damaging	Het
Pdxdc1	A	T	16: 13,854,405	I377N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phip	T	C	9: 82,906,988	K758E	possibly damaging	Het
Ptprm	C	T	17: 66,956,851	R467H	probably benign	Het
Scnn1b	C	T	7: 121,902,844	R242C	probably damaging	Het
Seh1l	T	C	18: 67,775,064	S19P	possibly damaging	Het
Slc28a1	T	A	7: 81,167,967	V528D	probably benign	Het
Slc6a17	G	T	3: 107,472,191	Q554K	probably benign	Het
Spag16	G	A	1: 70,299,769		probably null	Het
Srfbp1	T	A	18: 52,490,045	N377K	possibly damaging	Het
Stap2	A	G	17: 55,997,895	S296P	probably benign	Het
Tnr	A	T	1: 159,912,789	I1178F	probably damaging	Het
Tomt	C	T	7: 101,901,143	A139T	probably damaging	Het
Trak2	T	C	1: 58,935,808	Q75R	probably benign	Het
Tulp1	T	C	17: 28,364,494	K58E	probably benign	Het
Utp6	A	G	11: 79,943,229		probably null	Het
Vmn1r21	T	C	6: 57,844,013	T149A	probably benign	Het
Vmn1r238	C	T	18: 3,123,127	V96M	probably benign	Het
Vmn1r9	T	A	6: 57,071,681	I247N	probably damaging	Het
Vps33b	T	C	7: 80,282,493	C138R	possibly damaging	Het
Wnk1	A	T	6: 119,963,265	V837E	probably damaging	Het
Xirp2	C	T	2: 67,482,363	H59Y	possibly damaging	Het
Zbtb38	G	T	9: 96,686,381	D883E	probably benign	Het
Zbtb7a	C	A	10: 81,144,534	D187E	probably benign	Het
Zfp511	T	C	7: 140,037,529	V148A	probably damaging	Het
Zfp52	A	G	17: 21,560,430	D180G	possibly damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTCCAGTTCTAGAAGCACCC -3'
(R):5'- CTGGTAAGTGGGCTTCAAGG -3'

Sequencing Primer
(F):5'- TCACCTGCCGTGATGATGAG -3'
(R):5'- AAGTGGGCTTCAAGGTGAGTG -3'

Posted On

2022-03-16