Mutagenetix > Incidental Mutation

Incidental Mutation 'R8889:Ltn1'

700918

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8889 (G1)

Quality Score

175.009

Status

Validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 87432342 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039101] [ENSMUST00000039449] [ENSMUST00000232095]

AlphaFold

Q6A009

Predicted Effect

probably benign
Transcript: ENSMUST00000039101

SMART Domains

Protein: ENSMUSP00000049168
Gene: ENSMUSG00000041079

Domain	Start	End	E-Value	Type
RWD	12	136	3.17e-24	SMART
Pfam:DUF1115	162	284	1.6e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000039449

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000232095

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	T	A	9: 35,839,386	T47S	probably damaging	Het
Abca14	T	A	7: 120,216,383	L285I	probably damaging	Het
Abcc2	T	G	19: 43,807,132	S442R	possibly damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Ank1	T	C	8: 23,116,974	L1297P	probably damaging	Het
Ap3b1	G	A	13: 94,542,840	V997M	unknown	Het
Ash2l	T	C	8: 25,823,219	K413R	probably benign	Het
Cacnb1	A	T	11: 98,010,366	V220E	probably damaging	Het
Cacul1	A	T	19: 60,580,522	L66Q	probably damaging	Het
Camkv	C	T	9: 107,946,134	R120*	probably null	Het
Ccny	T	G	18: 9,345,235	S180R	probably damaging	Het
Cdh23	G	T	10: 60,307,505	H3012Q	probably damaging	Het
Clasp2	T	A	9: 113,880,183	L680Q	probably damaging	Het
Clip1	A	T	5: 123,579,502	S1241R	probably benign	Het
Cthrc1	T	A	15: 39,077,050	L16H	probably damaging	Het
Ctnna1	G	A	18: 35,239,533	V514I	possibly damaging	Het
Ddr1	A	C	17: 35,682,664	I852S	probably benign	Het
Echs1	A	C	7: 140,108,118	L258R	probably damaging	Het
Epha8	G	T	4: 136,934,539	H582N	probably benign	Het
Exph5	G	T	9: 53,376,655	G1679W	probably damaging	Het
Fhod3	G	A	18: 25,056,395		probably null	Het
Gm10803	G	A	2: 93,563,936	D18N	unknown	Het
Gpr152	T	A	19: 4,142,724	I88N	probably damaging	Het
Gpr179	T	C	11: 97,335,764	D1855G	possibly damaging	Het
H2al2a	T	A	2: 17,996,788	D29V	probably damaging	Het
Hnrnpf	T	G	6: 117,924,792	S346A	probably benign	Het
Hsd11b2	C	T	8: 105,522,631	R213C	probably damaging	Het
Il17rd	A	G	14: 27,099,973	D552G	possibly damaging	Het
Ipo9	T	C	1: 135,386,806	N904S	possibly damaging	Het
Klhl14	T	G	18: 21,558,163	T437P	possibly damaging	Het
Krt5	T	C	15: 101,710,750	M268V	probably benign	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Macf1	A	G	4: 123,355,243	L7165P	probably damaging	Het
Micall2	T	A	5: 139,717,499	H194L	probably damaging	Het
Mmp16	T	A	4: 18,051,820	Y270N	probably damaging	Het
Nme6	T	G	9: 109,839,638	F41V	probably damaging	Het
Npffr1	A	G	10: 61,614,160	N71S	possibly damaging	Het
Olfr1287	A	G	2: 111,449,622	I161V	probably benign	Het
Olfr409-ps1	T	C	11: 74,317,123	W33R	probably damaging	Het
Pard3b	T	A	1: 62,637,867	Y1186N	probably damaging	Het
Pcca	A	G	14: 122,557,711		probably benign	Het
Plekha8	A	G	6: 54,615,555		probably benign	Het
Ptpn14	T	A	1: 189,822,675	L144*	probably null	Het
Rad52	C	T	6: 119,913,080	R56C	probably damaging	Het
Rdx	C	T	9: 52,086,453	R576C	probably damaging	Het
Rnf135	C	T	11: 80,184,131	T72I	probably benign	Het
Robo4	G	T	9: 37,403,305	R196L	probably benign	Het
Rsf1	G	GACGTCGGCT	7: 97,579,909		probably benign	Het
Rsf1	A	T	7: 97,678,964	I1058F		Het
Ryr2	A	T	13: 11,785,104	V919E	probably damaging	Het
Slc39a6	A	T	18: 24,596,329	Y442*	probably null	Het
Slc4a11	T	G	2: 130,687,220	S437R	probably damaging	Het
Slc7a6	T	A	8: 106,195,902	V440E	probably damaging	Het
Sox2	A	T	3: 34,650,980	N189Y	possibly damaging	Het
Spata13	A	T	14: 60,756,581	M1161L	probably benign	Het
Spock3	T	A	8: 62,951,952	Y51*	probably null	Het
Sptbn1	A	G	11: 30,117,800	Y1805H	probably benign	Het
Tcerg1l	C	T	7: 138,397,531	W41*	probably null	Het
Tdrd9	A	G	12: 112,013,284	Y401C	probably benign	Het
Tex47	A	T	5: 7,305,115	I99F	probably damaging	Het
Tlr9	G	A	9: 106,222,635		probably benign	Het
Tmem209	T	A	6: 30,497,943	S276C	possibly damaging	Het
Tmprss11f	A	C	5: 86,539,759	S97A	possibly damaging	Het
Tnfaip8	ACACACTC	AC	18: 50,046,841		probably benign	Het
Ttc7	T	A	17: 87,330,092	M425K	probably damaging	Het
Ttn	C	T	2: 76,909,122	G3737D	unknown	Het
Unc13b	A	T	4: 43,176,484	R2437S	unknown	Het
Uqcrc1	C	T	9: 108,937,118	R58C	probably damaging	Het
Vmn1r128	A	G	7: 21,349,815	Y148C	possibly damaging	Het
Vmn1r193	T	C	13: 22,219,669	Y51C	probably benign	Het
Vmn2r112	A	G	17: 22,618,631	Y691C	probably damaging	Het
Vmn2r25	T	A	6: 123,823,610	D591V	probably damaging	Het
Vmn2r94	A	G	17: 18,244,073	S652P	possibly damaging	Het
Vps50	T	A	6: 3,536,967	C313S	probably damaging	Het
Vwa5b1	A	G	4: 138,610,730	V93A	probably benign	Het
Xrcc5	T	G	1: 72,343,031	D455E	possibly damaging	Het
Zdhhc6	T	A	19: 55,302,555		probably benign	Het
Zfp964	G	A	8: 69,663,755	G335D	probably damaging	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAAGCTTGAGACCAGAGACC -3'
(R):5'- TGTCAACTTCGGCTCTGCAG -3'

Sequencing Primer
(F):5'- ACTGAGCGAGTGAAGCCCAC -3'
(R):5'- AACTTCGGCTCTGCAGACTGAG -3'

Posted On

2022-03-16