Incidental Mutation 'R8879:Dnaja4'
ID 700920
Institutional Source Beutler Lab
Gene Symbol Dnaja4
Ensembl Gene ENSMUSG00000032285
Gene Name DnaJ heat shock protein family (Hsp40) member A4
Synonyms 1110021L12Rik, Hsj4, Dj4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 54698873-54716315 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 54714704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051822] [ENSMUST00000070070] [ENSMUST00000118771] [ENSMUST00000120452] [ENSMUST00000121204] [ENSMUST00000130368]
AlphaFold Q9JMC3
Predicted Effect probably benign
Transcript: ENSMUST00000051822
SMART Domains Protein: ENSMUSP00000056359
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
WD40 263 302 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070070
SMART Domains Protein: ENSMUSP00000070413
Gene: ENSMUSG00000032285

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 2.1e-15 PFAM
Pfam:CTDII 258 340 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118771
SMART Domains Protein: ENSMUSP00000112811
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120452
SMART Domains Protein: ENSMUSP00000112520
Gene: ENSMUSG00000032285

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_C 108 330 9.7e-35 PFAM
Pfam:DnaJ_CXXCXGXG 135 201 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121204
SMART Domains Protein: ENSMUSP00000113560
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
WD40 263 302 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130368
SMART Domains Protein: ENSMUSP00000123077
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 5 36 5.3e1 SMART
WD40 39 78 7.73e-6 SMART
WD40 81 120 3.21e-12 SMART
WD40 123 162 8.81e-10 SMART
WD40 165 204 1.49e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Dnaja4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Dnaja4 APN 9 54714510 missense possibly damaging 0.93
PIT4305001:Dnaja4 UTSW 9 54710634 missense probably benign 0.01
R2139:Dnaja4 UTSW 9 54709222 missense probably benign 0.01
R4837:Dnaja4 UTSW 9 54710644 missense probably benign 0.00
R5087:Dnaja4 UTSW 9 54699739 missense probably damaging 0.99
R5862:Dnaja4 UTSW 9 54699341 unclassified probably benign
R6722:Dnaja4 UTSW 9 54699754 missense probably damaging 0.99
R6985:Dnaja4 UTSW 9 54708395 missense probably benign 0.06
R7165:Dnaja4 UTSW 9 54709232 missense probably damaging 1.00
R7228:Dnaja4 UTSW 9 54714285 missense possibly damaging 0.88
R7762:Dnaja4 UTSW 9 54709210 missense probably benign 0.03
R9069:Dnaja4 UTSW 9 54714354 missense probably benign 0.01
R9609:Dnaja4 UTSW 9 54709360 missense probably null 1.00
X0057:Dnaja4 UTSW 9 54699804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAGGAGAAGCTTCCTCAG -3'
(R):5'- ATTCCATATGCAGACTAGAGGGG -3'

Sequencing Primer
(F):5'- TTCCCCCTCGGCAGAAG -3'
(R):5'- CATATGCAGACTAGAGGGGATTGAAC -3'
Posted On 2022-03-16