Incidental Mutation 'R8879:Usp43'
ID 700921
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Name ubiquitin specific peptidase 43
Synonyms C630032K07Rik
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67745349-67812979 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 67789707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
AlphaFold Q8BUM9
Predicted Effect probably benign
Transcript: ENSMUST00000021288
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108677
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67,782,245 (GRCm39) missense probably benign 0.08
IGL01536:Usp43 APN 11 67,746,764 (GRCm39) missense probably benign 0.01
IGL01754:Usp43 APN 11 67,747,007 (GRCm39) missense probably benign 0.06
IGL02057:Usp43 APN 11 67,747,113 (GRCm39) missense probably benign 0.02
IGL02638:Usp43 APN 11 67,746,581 (GRCm39) missense probably benign 0.06
IGL03105:Usp43 APN 11 67,770,802 (GRCm39) missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67,767,315 (GRCm39) missense probably damaging 1.00
IGL03380:Usp43 APN 11 67,766,142 (GRCm39) missense possibly damaging 0.67
R0207:Usp43 UTSW 11 67,767,325 (GRCm39) missense probably damaging 1.00
R0308:Usp43 UTSW 11 67,770,966 (GRCm39) missense probably damaging 1.00
R0350:Usp43 UTSW 11 67,767,324 (GRCm39) missense probably damaging 1.00
R0479:Usp43 UTSW 11 67,788,100 (GRCm39) missense possibly damaging 0.96
R1451:Usp43 UTSW 11 67,747,007 (GRCm39) missense probably benign 0.01
R1686:Usp43 UTSW 11 67,778,593 (GRCm39) missense probably damaging 0.99
R1750:Usp43 UTSW 11 67,770,779 (GRCm39) missense probably damaging 1.00
R1956:Usp43 UTSW 11 67,795,159 (GRCm39) missense probably damaging 1.00
R2107:Usp43 UTSW 11 67,746,566 (GRCm39) frame shift probably null
R2108:Usp43 UTSW 11 67,746,566 (GRCm39) frame shift probably null
R2112:Usp43 UTSW 11 67,812,536 (GRCm39) missense probably damaging 1.00
R2162:Usp43 UTSW 11 67,770,795 (GRCm39) missense probably damaging 1.00
R2336:Usp43 UTSW 11 67,782,258 (GRCm39) nonsense probably null
R4031:Usp43 UTSW 11 67,804,659 (GRCm39) missense probably damaging 1.00
R4355:Usp43 UTSW 11 67,782,290 (GRCm39) missense probably benign 0.01
R4410:Usp43 UTSW 11 67,746,716 (GRCm39) missense probably benign 0.00
R4479:Usp43 UTSW 11 67,747,233 (GRCm39) missense possibly damaging 0.96
R4569:Usp43 UTSW 11 67,789,788 (GRCm39) missense probably damaging 1.00
R4569:Usp43 UTSW 11 67,766,178 (GRCm39) nonsense probably null
R4737:Usp43 UTSW 11 67,746,331 (GRCm39) missense probably damaging 1.00
R5395:Usp43 UTSW 11 67,788,184 (GRCm39) critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67,804,709 (GRCm39) missense probably damaging 0.99
R5686:Usp43 UTSW 11 67,812,742 (GRCm39) unclassified probably benign
R6106:Usp43 UTSW 11 67,770,733 (GRCm39) missense probably benign 0.00
R7205:Usp43 UTSW 11 67,774,110 (GRCm39) missense probably null 1.00
R7360:Usp43 UTSW 11 67,767,155 (GRCm39) splice site probably null
R7426:Usp43 UTSW 11 67,783,842 (GRCm39) missense possibly damaging 0.60
R7755:Usp43 UTSW 11 67,782,294 (GRCm39) missense possibly damaging 0.94
R7937:Usp43 UTSW 11 67,746,615 (GRCm39) missense probably damaging 0.96
R8054:Usp43 UTSW 11 67,782,284 (GRCm39) missense probably damaging 0.96
R8410:Usp43 UTSW 11 67,747,146 (GRCm39) missense probably damaging 1.00
R8792:Usp43 UTSW 11 67,767,244 (GRCm39) nonsense probably null
R8865:Usp43 UTSW 11 67,789,788 (GRCm39) missense probably damaging 1.00
R8906:Usp43 UTSW 11 67,782,307 (GRCm39) missense possibly damaging 0.51
R9287:Usp43 UTSW 11 67,770,922 (GRCm39) missense probably damaging 0.98
R9303:Usp43 UTSW 11 67,767,345 (GRCm39) missense probably damaging 1.00
R9305:Usp43 UTSW 11 67,767,345 (GRCm39) missense probably damaging 1.00
Z1088:Usp43 UTSW 11 67,746,866 (GRCm39) missense probably benign 0.39
Z1176:Usp43 UTSW 11 67,812,667 (GRCm39) missense unknown
Z1177:Usp43 UTSW 11 67,812,858 (GRCm39) missense unknown
Z1177:Usp43 UTSW 11 67,746,634 (GRCm39) missense possibly damaging 0.56
Z1186:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1186:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1187:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1187:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1188:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1188:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1189:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1189:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1190:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1190:Usp43 UTSW 11 67,746,549 (GRCm39) small insertion probably benign
Z1190:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1191:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1191:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1192:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1192:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGACTGCACACCCCTTTCT -3'
(R):5'- AAAAGCGATTCATGTGTTTTGGGG -3'

Sequencing Primer
(F):5'- TCTTTAATTGCCTATTACCTGAGTGG -3'
(R):5'- ACTTGACATATTTCCGGGGAC -3'
Posted On 2022-03-16