Incidental Mutation 'R8817:Plcb1'
ID 700937
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R8817 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 134786067-135475258 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to A at 135333509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably benign
Transcript: ENSMUST00000070724
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,276,998 Y320H probably benign Het
Aass A T 6: 23,097,196 Y41* probably null Het
AI429214 G A 8: 36,994,114 V139I probably benign Het
Cacna1a G A 8: 84,638,797 A2190T probably benign Het
Cutc T C 19: 43,755,674 V38A probably benign Het
Cxcl10 G T 5: 92,347,371 P98H probably damaging Het
Dopey1 T C 9: 86,513,950 S822P possibly damaging Het
Dusp19 T C 2: 80,624,287 L117P probably damaging Het
Emc3 A G 6: 113,515,907 F261S probably damaging Het
Ephx2 T C 14: 66,107,276 T200A probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
Ethe1 T C 7: 24,606,302 I158T probably damaging Het
Fancm C T 12: 65,120,557 R1547C probably damaging Het
Fer1l4 T A 2: 156,048,223 T261S probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gabrp A T 11: 33,554,464 S284T possibly damaging Het
Gga2 G A 7: 121,991,622 R488* probably null Het
Gm14085 A T 2: 122,518,507 T305S possibly damaging Het
Gm436 A G 4: 144,673,791 V139A probably benign Het
Gm9758 A G 5: 14,912,216 L126S probably damaging Het
Gse1 T C 8: 120,567,803 F290L probably damaging Het
Hdgfl1 A G 13: 26,770,085 S2P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Huwe1 A G X: 151,886,997 K1482R probably benign Het
Lama2 A T 10: 27,187,873 W1307R probably damaging Het
Map3k6 A G 4: 133,246,760 K517E probably benign Het
Mbl1 T A 14: 41,153,598 L3Q unknown Het
Mepe G T 5: 104,337,285 R97L probably benign Het
Minpp1 T A 19: 32,486,347 M136K possibly damaging Het
Mrgprb1 T A 7: 48,447,322 I281F probably benign Het
Naip5 T C 13: 100,212,699 I1374V probably benign Het
Olfr1259 A G 2: 89,943,446 L223S probably damaging Het
Olfr603 A T 7: 103,383,618 I128N probably damaging Het
Olfr761 A G 17: 37,952,382 I214T probably damaging Het
Olfr954 C T 9: 39,462,091 S217F probably damaging Het
Olfr970 G T 9: 39,819,643 M1I probably null Het
Pamr1 T G 2: 102,634,421 V305G probably benign Het
Pcbp3 T C 10: 76,789,836 T125A probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Pitpnm3 T C 11: 72,051,068 E971G possibly damaging Het
Pkdrej A G 15: 85,818,573 V1054A probably damaging Het
Prpf40a T C 2: 53,152,959 K480E probably damaging Het
Psd3 A G 8: 67,960,483 I465T possibly damaging Het
Pskh1 C T 8: 105,929,720 R343W probably damaging Het
Ptprz1 A T 6: 23,007,372 T1645S probably damaging Het
Rasal1 T C 5: 120,670,351 F483L probably damaging Het
Rbm28 T C 6: 29,155,024 probably benign Het
Recql G A 6: 142,358,886 probably benign Het
Rnf40 T C 7: 127,597,160 V760A probably damaging Het
Rp1l1 A T 14: 64,030,636 R1224W probably benign Het
Rpgrip1 T C 14: 52,140,599 V468A probably benign Het
Ryr2 T A 13: 11,735,623 I1921F possibly damaging Het
Sirpa G A 2: 129,593,638 G9D unknown Het
Slc40a1 A C 1: 45,909,539 V527G probably damaging Het
Smarca4 T A 9: 21,636,201 M260K probably benign Het
Smarca5 A T 8: 80,733,750 M119K probably benign Het
Smg1 A G 7: 118,159,664 V2206A unknown Het
Sp4 A T 12: 118,261,889 V580D possibly damaging Het
Spata31d1c G A 13: 65,034,562 C75Y probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srcap T C 7: 127,553,223 S2220P probably benign Het
Stra6 G T 9: 58,151,982 V543F possibly damaging Het
Tenm4 T A 7: 96,874,128 F1626I probably benign Het
Tjp1 T C 7: 65,303,062 N1508S probably benign Het
Trrap T A 5: 144,845,538 L3298Q probably damaging Het
Tsn A G 1: 118,304,740 L135P probably damaging Het
Ttl A T 2: 129,068,858 H54L probably damaging Het
Ttn T A 2: 76,829,907 T12110S unknown Het
Uba6 T C 5: 86,148,913 I306V probably null Het
Ubap2 A G 4: 41,223,425 S204P possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ush2a A T 1: 188,263,034 M1L probably benign Het
Vmn1r159 C A 7: 22,843,134 V158F probably benign Het
Wif1 A G 10: 121,096,716 H333R possibly damaging Het
Zfp282 T A 6: 47,904,826 N482K probably benign Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8693:Plcb1 UTSW 2 135252776 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
R8950:Plcb1 UTSW 2 135337519 missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135340695 missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135325690 missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135347465 missense probably benign 0.00
R9459:Plcb1 UTSW 2 135322638 missense probably benign 0.03
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTTTGCTTCCAGGGGACAG -3'
(R):5'- ATCTCACTAGTGATCCCATGGGG -3'

Sequencing Primer
(F):5'- TTCCAGGGGACAGCTGGC -3'
(R):5'- GTGAAATTCTCGATCAGTTGGAC -3'
Posted On 2022-03-23