Incidental Mutation 'R0761:2610008E11Rik'
ID70095
Institutional Source Beutler Lab
Gene Symbol 2610008E11Rik
Ensembl Gene ENSMUSG00000060301
Gene NameRIKEN cDNA 2610008E11 gene
Synonyms
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79064374-79097600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79067999 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 133 (Y133C)
Ref Sequence ENSEMBL: ENSMUSP00000151709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039271] [ENSMUST00000218854] [ENSMUST00000220220]
Predicted Effect probably benign
Transcript: ENSMUST00000039271
AA Change: Y161C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044020
Gene: ENSMUSG00000060301
AA Change: Y161C

DomainStartEndE-ValueType
KRAB 10 70 6.95e-32 SMART
ZnF_C2H2 215 237 1.61e2 SMART
ZnF_C2H2 243 266 4.24e-4 SMART
ZnF_C2H2 272 295 1.03e-2 SMART
ZnF_C2H2 301 324 1.76e-1 SMART
ZnF_C2H2 330 352 1.45e-2 SMART
ZnF_C2H2 358 380 1.58e-3 SMART
ZnF_C2H2 386 408 2.75e-3 SMART
ZnF_C2H2 414 437 4.61e-5 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 5.81e-2 SMART
ZnF_C2H2 499 521 4.79e-3 SMART
ZnF_C2H2 527 549 3.58e-2 SMART
ZnF_C2H2 555 577 3.44e-4 SMART
ZnF_C2H2 583 605 6.78e-3 SMART
ZnF_C2H2 611 633 3.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218854
AA Change: Y133C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000220220
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in 2610008E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:2610008E11Rik APN 10 79088313 missense possibly damaging 0.79
IGL01905:2610008E11Rik APN 10 79067748 missense probably damaging 1.00
IGL02522:2610008E11Rik APN 10 79067799 missense probably benign 0.27
IGL02999:2610008E11Rik APN 10 79067590 missense possibly damaging 0.74
K7371:2610008E11Rik UTSW 10 79067933 missense probably benign 0.01
R0557:2610008E11Rik UTSW 10 79067685 missense probably damaging 0.99
R1528:2610008E11Rik UTSW 10 79067696 missense possibly damaging 0.72
R1801:2610008E11Rik UTSW 10 79067396 missense probably damaging 1.00
R1923:2610008E11Rik UTSW 10 79067909 missense probably damaging 0.98
R2444:2610008E11Rik UTSW 10 79068727 missense possibly damaging 0.95
R4223:2610008E11Rik UTSW 10 79094452 missense probably damaging 1.00
R4653:2610008E11Rik UTSW 10 79067430 missense probably benign 0.42
R5127:2610008E11Rik UTSW 10 79066992 missense probably damaging 1.00
R5784:2610008E11Rik UTSW 10 79067607 missense possibly damaging 0.68
R6175:2610008E11Rik UTSW 10 79066614 missense probably damaging 0.98
R6990:2610008E11Rik UTSW 10 79067091 missense probably damaging 0.99
R7055:2610008E11Rik UTSW 10 79067847 missense probably damaging 0.98
R7133:2610008E11Rik UTSW 10 79066639 missense probably benign 0.02
R7133:2610008E11Rik UTSW 10 79066640 missense probably benign 0.33
R7142:2610008E11Rik UTSW 10 79067612 missense probably damaging 1.00
R7382:2610008E11Rik UTSW 10 79067269 missense probably damaging 1.00
R7577:2610008E11Rik UTSW 10 79066491 missense possibly damaging 0.95
R8103:2610008E11Rik UTSW 10 79067834 missense probably benign
R8117:2610008E11Rik UTSW 10 79094455 missense probably benign 0.07
R8296:2610008E11Rik UTSW 10 79067734 missense probably benign 0.09
R8316:2610008E11Rik UTSW 10 79067739 missense probably damaging 1.00
R8477:2610008E11Rik UTSW 10 79088340 missense probably benign 0.00
R8790:2610008E11Rik UTSW 10 79092451 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCCTTCCGATGAAAAGACTTCCTGC -3'
(R):5'- TTTGGGGCCATTGACACCCTTC -3'

Sequencing Primer
(F):5'- ATTTCCCAGCACTGTGGAGAG -3'
(R):5'- GTATTTACTGCCCAAAGCATGG -3'
Posted On2013-09-30