Incidental Mutation 'R0761:Psma6'
ID70098
Institutional Source Beutler Lab
Gene Symbol Psma6
Ensembl Gene ENSMUSG00000021024
Gene Nameproteasome (prosome, macropain) subunit, alpha type 6
Synonyms
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55384222-55418454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55412342 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 170 (W170R)
Ref Sequence ENSEMBL: ENSMUSP00000124781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021412] [ENSMUST00000162711] [ENSMUST00000163070]
Predicted Effect probably benign
Transcript: ENSMUST00000021412
AA Change: W189R

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021412
Gene: ENSMUSG00000021024
AA Change: W189R

DomainStartEndE-ValueType
Proteasome_A_N 9 31 3.21e-9 SMART
Pfam:Proteasome 32 220 3.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162711
SMART Domains Protein: ENSMUSP00000123914
Gene: ENSMUSG00000021024

DomainStartEndE-ValueType
Pfam:Proteasome_A_N 9 25 4.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162972
Predicted Effect possibly damaging
Transcript: ENSMUST00000163070
AA Change: W170R

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124781
Gene: ENSMUSG00000021024
AA Change: W170R

DomainStartEndE-ValueType
Pfam:Proteasome 13 201 1.5e-56 PFAM
Meta Mutation Damage Score 0.1515 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Psma6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Psma6 APN 12 55407469 missense probably damaging 1.00
IGL02658:Psma6 APN 12 55412211 missense probably benign 0.07
IGL02991:Psma6 APN 12 55407572 splice site probably benign
R1758:Psma6 UTSW 12 55407532 missense probably damaging 0.99
R2103:Psma6 UTSW 12 55408057 missense probably benign 0.23
R2897:Psma6 UTSW 12 55408044 missense probably benign 0.00
R5333:Psma6 UTSW 12 55407428 intron probably benign
R5782:Psma6 UTSW 12 55410256 missense possibly damaging 0.68
R7432:Psma6 UTSW 12 55398828 intron probably benign
R8302:Psma6 UTSW 12 55410181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACTCTCCCTAGTCATCTAATTAAGCCA -3'
(R):5'- agtcgagtctTATTTTCCTATCTTGTGTCTGT -3'

Sequencing Primer
(F):5'- GGACAGTTTAACACATCTAACTGG -3'
(R):5'- CCCCCATGTGAGCTGAATG -3'
Posted On2013-09-30