Incidental Mutation 'R0761:Rps6ka5'
ID70099
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score192
Status Validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100570882 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 530 (A530T)
Ref Sequence ENSEMBL: ENSMUSP00000152481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043599
AA Change: A595T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: A595T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221246
Predicted Effect unknown
Transcript: ENSMUST00000221356
AA Change: A106T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221379
Predicted Effect probably damaging
Transcript: ENSMUST00000222731
AA Change: A530T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223531
Meta Mutation Damage Score 0.2227 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R7926:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCAAGAGAAATAGCAAGCGTCCT -3'
(R):5'- AGATTTTGTCACCTCGGCTCTCAGT -3'

Sequencing Primer
(F):5'- CTAAAGGCTGACAGCTACTCTAAGG -3'
(R):5'- CTCGGCTCTCAGTTTTTAAAGTG -3'
Posted On2013-09-30