Incidental Mutation 'R0761:Rps6ka5'
ID70099
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score192
Status Validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100570882 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 530 (A530T)
Ref Sequence ENSEMBL: ENSMUSP00000152481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043599
AA Change: A595T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: A595T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221246
Predicted Effect unknown
Transcript: ENSMUST00000221356
AA Change: A106T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221379
Predicted Effect probably damaging
Transcript: ENSMUST00000222731
AA Change: A530T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223531
Meta Mutation Damage Score 0.2227 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
chard UTSW 12 100616083 missense probably damaging 1.00
Ramp UTSW 12 100575705 missense possibly damaging 0.85
zwiebel UTSW 12 100678538 missense probably damaging 0.99
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
R8292:Rps6ka5 UTSW 12 100678532 missense possibly damaging 0.83
R8324:Rps6ka5 UTSW 12 100558487 missense possibly damaging 0.92
R8428:Rps6ka5 UTSW 12 100575241 nonsense probably null
R8913:Rps6ka5 UTSW 12 100554336 missense
Predicted Primers PCR Primer
(F):5'- GCCCAAGAGAAATAGCAAGCGTCCT -3'
(R):5'- AGATTTTGTCACCTCGGCTCTCAGT -3'

Sequencing Primer
(F):5'- CTAAAGGCTGACAGCTACTCTAAGG -3'
(R):5'- CTCGGCTCTCAGTTTTTAAAGTG -3'
Posted On2013-09-30