Incidental Mutation 'R0761:Clmn'
ID70100
Institutional Source Beutler Lab
Gene Symbol Clmn
Ensembl Gene ENSMUSG00000021097
Gene Namecalmin
Synonyms
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104763117-104865076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104781558 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 577 (N577Y)
Ref Sequence ENSEMBL: ENSMUSP00000152070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109936] [ENSMUST00000109937] [ENSMUST00000222323] [ENSMUST00000223103] [ENSMUST00000223177] [ENSMUST00000223342]
Predicted Effect probably damaging
Transcript: ENSMUST00000109936
AA Change: N577Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105562
Gene: ENSMUSG00000021097
AA Change: N577Y

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 996 1013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109937
AA Change: N577Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105563
Gene: ENSMUSG00000021097
AA Change: N577Y

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 1027 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222412
Predicted Effect probably damaging
Transcript: ENSMUST00000223103
AA Change: N577Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223177
AA Change: N577Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223342
AA Change: N577Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1566 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Clmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Clmn APN 12 104774551 critical splice acceptor site probably null
IGL01509:Clmn APN 12 104780903 missense probably benign 0.00
IGL01530:Clmn APN 12 104791856 missense probably damaging 1.00
IGL01768:Clmn APN 12 104781719 missense probably damaging 0.99
IGL01779:Clmn APN 12 104782140 missense probably benign 0.04
IGL02139:Clmn APN 12 104781099 missense probably benign 0.01
IGL02157:Clmn APN 12 104781918 missense probably benign 0.00
IGL02519:Clmn APN 12 104791853 missense probably damaging 1.00
IGL02820:Clmn APN 12 104773234 missense probably damaging 0.99
IGL03036:Clmn APN 12 104774523 missense probably damaging 0.97
R0255:Clmn UTSW 12 104781764 missense probably benign
R0478:Clmn UTSW 12 104785491 missense probably damaging 0.99
R0739:Clmn UTSW 12 104781017 missense possibly damaging 0.55
R0834:Clmn UTSW 12 104771826 missense probably damaging 1.00
R0834:Clmn UTSW 12 104771827 missense probably damaging 1.00
R0864:Clmn UTSW 12 104790015 missense possibly damaging 0.94
R1569:Clmn UTSW 12 104781081 missense probably damaging 1.00
R1638:Clmn UTSW 12 104782022 missense probably benign 0.13
R1940:Clmn UTSW 12 104790102 missense probably damaging 1.00
R1974:Clmn UTSW 12 104791862 missense probably damaging 1.00
R2113:Clmn UTSW 12 104780808 missense probably benign
R4815:Clmn UTSW 12 104785566 missense probably damaging 1.00
R4863:Clmn UTSW 12 104797094 missense probably damaging 1.00
R4883:Clmn UTSW 12 104782048 missense probably benign 0.04
R5577:Clmn UTSW 12 104777070 missense probably damaging 1.00
R5853:Clmn UTSW 12 104783902 splice site probably null
R5867:Clmn UTSW 12 104781755 missense probably damaging 0.98
R6041:Clmn UTSW 12 104781872 missense probably benign 0.00
R6093:Clmn UTSW 12 104771956 missense probably benign 0.00
R6233:Clmn UTSW 12 104785455 missense probably damaging 1.00
R6239:Clmn UTSW 12 104780845 missense probably benign 0.00
R6628:Clmn UTSW 12 104773786 missense probably damaging 1.00
R6771:Clmn UTSW 12 104773782 missense probably benign 0.04
R7448:Clmn UTSW 12 104785428 missense possibly damaging 0.90
R7633:Clmn UTSW 12 104782112 missense probably benign
X0028:Clmn UTSW 12 104785402 missense probably benign 0.11
Z1177:Clmn UTSW 12 104781376 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGCTTCTTGGGCTCCAATCTGGAC -3'
(R):5'- AGGATGCCTCGTGTAGTAAGGACC -3'

Sequencing Primer
(F):5'- CTCCAATCTGGACTCGGC -3'
(R):5'- CGTGTAGTAAGGACCCTTTCTATAGC -3'
Posted On2013-09-30