Mutagenetix > Incidental Mutation

Incidental Mutation 'R9234:Zfpm2'

701006

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9234 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41103074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 985 (Y985C)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000053467
AA Change: Y985C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: Y985C

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000230319
AA Change: Y853C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430550D23Rik	A	G	2: 156,003,878	Y20H	probably benign	Het
Arid5b	A	G	10: 68,128,798	F348L	possibly damaging	Het
Bms1	C	A	6: 118,398,083	A777S	probably damaging	Het
C2cd3	A	G	7: 100,399,805	Y61C		Het
Caprin2	A	T	6: 148,842,839	Y1029*	probably null	Het
Casp1	A	T	9: 5,303,128	D194V	probably benign	Het
Crkl	A	G	16: 17,468,958	E126G	probably damaging	Het
Crp	A	T	1: 172,698,846	D166V	probably damaging	Het
Dnah10	A	C	5: 124,741,925	D425A	possibly damaging	Het
Dnah11	A	T	12: 117,987,360	L3071Q	probably damaging	Het
Dnah9	T	A	11: 66,033,925	I2168F	possibly damaging	Het
Elp3	T	A	14: 65,551,471	I388F	probably damaging	Het
Espn	C	A	4: 152,132,923		probably null	Het
Fbrsl1	G	T	5: 110,363,384	F504L	probably benign	Het
Fzd9	A	C	5: 135,250,686	M115R	probably damaging	Het
Git2	A	T	5: 114,761,621	Y224N	possibly damaging	Het
Gm9195	A	T	14: 72,458,346	Y1415*	probably null	Het
Gnpat	T	A	8: 124,883,440	L454Q	probably damaging	Het
Grm5	C	T	7: 88,074,232	P577S	probably damaging	Het
Hfm1	T	C	5: 106,893,468	N683S	probably benign	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Leng8	C	A	7: 4,142,248	P216T	probably damaging	Het
Letm2	C	A	8: 25,594,086	R43L	probably benign	Het
Lims2	A	T	18: 31,957,890	Y309F	probably benign	Het
Llgl1	T	C	11: 60,710,130		probably null	Het
Ltn1	A	T	16: 87,397,201	D1417E	probably damaging	Het
Map4k4	T	A	1: 39,990,101	N345K	unknown	Het
Mapre2	T	C	18: 23,804,179	I26T	probably benign	Het
Nfe2	A	G	15: 103,251,209		probably benign	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Ntrk1	A	G	3: 87,788,315		probably null	Het
Olfr187	T	C	16: 59,036,426	N104D	probably benign	Het
Olfr623	T	A	7: 103,660,743	Y169F	possibly damaging	Het
Olfr670	A	G	7: 104,960,444	F96S	probably damaging	Het
Otud7b	G	T	3: 96,140,460	Q43H	probably damaging	Het
Pcdhb5	T	C	18: 37,320,642	V25A	probably benign	Het
Pcolce2	A	G	9: 95,678,386	T163A	probably benign	Het
Pdgfra	T	A	5: 75,163,601	V39E	possibly damaging	Het
Pdgfrb	T	A	18: 61,061,228	W26R	probably null	Het
Pigp	T	A	16: 94,364,663	*206Y	probably null	Het
Pip5kl1	G	T	2: 32,578,199	G126C	probably benign	Het
Plekhg2	G	T	7: 28,364,790	T442K	probably benign	Het
Prmt5	A	T	14: 54,511,217	S375T	possibly damaging	Het
Rnf213	T	A	11: 119,450,117	M3529K		Het
Ror2	C	A	13: 53,111,338	D573Y	probably damaging	Het
Shank1	A	G	7: 44,313,155	T98A	unknown	Het
Shcbp1	A	T	8: 4,748,800	I373K	possibly damaging	Het
Slc25a42	A	G	8: 70,190,086	S64P	probably damaging	Het
Smco3	T	A	6: 136,831,412	I155F	probably damaging	Het
Snx4	C	A	16: 33,266,791	S102*	probably null	Het
Snx4	T	A	16: 33,287,699	S288T	probably benign	Het
Socs4	A	G	14: 47,290,259	N217S	probably benign	Het
Tatdn2	G	A	6: 113,702,722		probably null	Het
Tmprss2	A	G	16: 97,578,621	Y160H	probably damaging	Het
Trim37	T	C	11: 87,145,567	I158T	possibly damaging	Het
Trip11	C	T	12: 101,845,731		probably null	Het
Ubr3	G	A	2: 69,897,646	A118T	probably benign	Het
Ubxn7	T	C	16: 32,360,077		probably null	Het
Unc5cl	C	T	17: 48,463,630	H369Y	probably damaging	Het
Unc5d	A	T	8: 28,760,849	N263K	probably damaging	Het
Vmn2r59	A	G	7: 42,012,483	I636T	possibly damaging	Het
Vps13d	G	T	4: 145,149,222	Q1578K		Het
Wnk2	T	C	13: 49,070,798	D1171G	probably damaging	Het
Zpbp2	A	T	11: 98,552,572	N77I	probably damaging	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GCCCTGAAGTCAGCTTTGAAAG -3'
(R):5'- TGCTTGAGTCCACCATTCAC -3'

Sequencing Primer
(F):5'- CTGAAGTCAGCTTTGAAAGAAACATG -3'
(R):5'- TGAGTCCACCATTCACTATGACCATG -3'

Posted On

2022-03-25