Incidental Mutation 'R9234:Zfpm2'
ID 701006
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9234 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41103074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 985 (Y985C)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably damaging
Transcript: ENSMUST00000053467
AA Change: Y985C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: Y985C

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230319
AA Change: Y853C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 156,003,878 Y20H probably benign Het
Arid5b A G 10: 68,128,798 F348L possibly damaging Het
Bms1 C A 6: 118,398,083 A777S probably damaging Het
C2cd3 A G 7: 100,399,805 Y61C Het
Caprin2 A T 6: 148,842,839 Y1029* probably null Het
Casp1 A T 9: 5,303,128 D194V probably benign Het
Crkl A G 16: 17,468,958 E126G probably damaging Het
Crp A T 1: 172,698,846 D166V probably damaging Het
Dnah10 A C 5: 124,741,925 D425A possibly damaging Het
Dnah11 A T 12: 117,987,360 L3071Q probably damaging Het
Dnah9 T A 11: 66,033,925 I2168F possibly damaging Het
Elp3 T A 14: 65,551,471 I388F probably damaging Het
Espn C A 4: 152,132,923 probably null Het
Fbrsl1 G T 5: 110,363,384 F504L probably benign Het
Fzd9 A C 5: 135,250,686 M115R probably damaging Het
Git2 A T 5: 114,761,621 Y224N possibly damaging Het
Gm9195 A T 14: 72,458,346 Y1415* probably null Het
Gnpat T A 8: 124,883,440 L454Q probably damaging Het
Grm5 C T 7: 88,074,232 P577S probably damaging Het
Hfm1 T C 5: 106,893,468 N683S probably benign Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Leng8 C A 7: 4,142,248 P216T probably damaging Het
Letm2 C A 8: 25,594,086 R43L probably benign Het
Lims2 A T 18: 31,957,890 Y309F probably benign Het
Llgl1 T C 11: 60,710,130 probably null Het
Ltn1 A T 16: 87,397,201 D1417E probably damaging Het
Map4k4 T A 1: 39,990,101 N345K unknown Het
Mapre2 T C 18: 23,804,179 I26T probably benign Het
Nfe2 A G 15: 103,251,209 probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Ntrk1 A G 3: 87,788,315 probably null Het
Olfr187 T C 16: 59,036,426 N104D probably benign Het
Olfr623 T A 7: 103,660,743 Y169F possibly damaging Het
Olfr670 A G 7: 104,960,444 F96S probably damaging Het
Otud7b G T 3: 96,140,460 Q43H probably damaging Het
Pcdhb5 T C 18: 37,320,642 V25A probably benign Het
Pcolce2 A G 9: 95,678,386 T163A probably benign Het
Pdgfra T A 5: 75,163,601 V39E possibly damaging Het
Pdgfrb T A 18: 61,061,228 W26R probably null Het
Pigp T A 16: 94,364,663 *206Y probably null Het
Pip5kl1 G T 2: 32,578,199 G126C probably benign Het
Plekhg2 G T 7: 28,364,790 T442K probably benign Het
Prmt5 A T 14: 54,511,217 S375T possibly damaging Het
Rnf213 T A 11: 119,450,117 M3529K Het
Ror2 C A 13: 53,111,338 D573Y probably damaging Het
Shank1 A G 7: 44,313,155 T98A unknown Het
Shcbp1 A T 8: 4,748,800 I373K possibly damaging Het
Slc25a42 A G 8: 70,190,086 S64P probably damaging Het
Smco3 T A 6: 136,831,412 I155F probably damaging Het
Snx4 C A 16: 33,266,791 S102* probably null Het
Snx4 T A 16: 33,287,699 S288T probably benign Het
Socs4 A G 14: 47,290,259 N217S probably benign Het
Tatdn2 G A 6: 113,702,722 probably null Het
Tmprss2 A G 16: 97,578,621 Y160H probably damaging Het
Trim37 T C 11: 87,145,567 I158T possibly damaging Het
Trip11 C T 12: 101,845,731 probably null Het
Ubr3 G A 2: 69,897,646 A118T probably benign Het
Ubxn7 T C 16: 32,360,077 probably null Het
Unc5cl C T 17: 48,463,630 H369Y probably damaging Het
Unc5d A T 8: 28,760,849 N263K probably damaging Het
Vmn2r59 A G 7: 42,012,483 I636T possibly damaging Het
Vps13d G T 4: 145,149,222 Q1578K Het
Wnk2 T C 13: 49,070,798 D1171G probably damaging Het
Zpbp2 A T 11: 98,552,572 N77I probably damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCCCTGAAGTCAGCTTTGAAAG -3'
(R):5'- TGCTTGAGTCCACCATTCAC -3'

Sequencing Primer
(F):5'- CTGAAGTCAGCTTTGAAAGAAACATG -3'
(R):5'- TGAGTCCACCATTCACTATGACCATG -3'
Posted On 2022-03-25