Incidental Mutation 'R0761:Pacs2'
ID70101
Institutional Source Beutler Lab
Gene Symbol Pacs2
Ensembl Gene ENSMUSG00000021143
Gene Namephosphofurin acidic cluster sorting protein 2
Synonyms6720425G15Rik, Pacs1l
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score195
Status Validated
Chromosome12
Chromosomal Location113014508-113074401 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 113060068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084891] [ENSMUST00000220541] [ENSMUST00000223502]
Predicted Effect probably benign
Transcript: ENSMUST00000084891
SMART Domains Protein: ENSMUSP00000081953
Gene: ENSMUSG00000021143

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 281 296 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
Pfam:Pacs-1 474 888 1.4e-208 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197963
Predicted Effect probably benign
Transcript: ENSMUST00000220541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220715
Predicted Effect probably benign
Transcript: ENSMUST00000223502
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased sensitivity to TRAIL-induced spleen apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Pacs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Pacs2 APN 12 113056842 missense probably benign 0.01
IGL01830:Pacs2 APN 12 113056954 nonsense probably null
IGL02229:Pacs2 APN 12 113056800 splice site probably benign
IGL02307:Pacs2 APN 12 113070773 missense probably damaging 1.00
IGL02700:Pacs2 APN 12 113061710 missense probably damaging 1.00
BB003:Pacs2 UTSW 12 113060752 missense probably damaging 1.00
BB013:Pacs2 UTSW 12 113060752 missense probably damaging 1.00
R0241:Pacs2 UTSW 12 113069270 splice site probably benign
R0433:Pacs2 UTSW 12 113056844 missense possibly damaging 0.77
R0512:Pacs2 UTSW 12 113050927 missense probably damaging 0.99
R2017:Pacs2 UTSW 12 113062457 missense probably damaging 1.00
R2070:Pacs2 UTSW 12 113061111 missense probably damaging 1.00
R2162:Pacs2 UTSW 12 113050947 missense probably benign
R2231:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2232:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2396:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2397:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R3010:Pacs2 UTSW 12 113061080 missense probably benign
R3403:Pacs2 UTSW 12 113050950 missense probably damaging 1.00
R3950:Pacs2 UTSW 12 113061113 missense probably damaging 1.00
R3952:Pacs2 UTSW 12 113061113 missense probably damaging 1.00
R4518:Pacs2 UTSW 12 113060669 missense probably benign 0.31
R5673:Pacs2 UTSW 12 113068998 missense probably damaging 1.00
R5693:Pacs2 UTSW 12 113049906 missense probably damaging 1.00
R7212:Pacs2 UTSW 12 113061692 missense possibly damaging 0.77
R7926:Pacs2 UTSW 12 113060752 missense probably damaging 1.00
R8032:Pacs2 UTSW 12 113061658 missense probably damaging 1.00
R8224:Pacs2 UTSW 12 113059760 missense probably damaging 1.00
Z1177:Pacs2 UTSW 12 113070730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTCTATGCAGTGTGAGACCC -3'
(R):5'- TGAACAAGGATCACCAGGCAGC -3'

Sequencing Primer
(F):5'- CTCCCCATGAGTCCTGAATAG -3'
(R):5'- TTTTCAGAGTATGAGAACACAAACCC -3'
Posted On2013-09-30