Incidental Mutation 'R9243:Zzz3'
ID 701084
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9243 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152428283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 326 (D326G)
Ref Sequence ENSEMBL: ENSMUSP00000101706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000089982
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: D326G

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106100
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: D326G

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106101
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: D326G

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106103
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200570
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,141,252 S1816R probably benign Het
Appl1 A T 14: 26,927,753 F605L possibly damaging Het
Cacna1g T A 11: 94,457,067 I732F possibly damaging Het
Capg T A 6: 72,561,087 S319T probably benign Het
Cdh17 T A 4: 11,771,333 F38L probably benign Het
Cep295 T A 9: 15,332,309 N1617I probably benign Het
Cep57 C T 9: 13,826,908 probably benign Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
Dock7 A G 4: 98,969,634 V1481A unknown Het
Exoc2 T C 13: 30,925,795 K197E probably benign Het
Fancg C T 4: 43,006,565 V330I possibly damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gad2 A G 2: 22,635,041 E279G possibly damaging Het
Gria1 A G 11: 57,238,062 Y454C probably benign Het
Grik3 C T 4: 125,707,897 R856C probably benign Het
Hdac4 C A 1: 91,972,789 R622I probably damaging Het
Hdac4 T C 1: 91,972,790 R622G probably benign Het
Idh1 A G 1: 65,168,497 probably null Het
Igf1r A G 7: 68,212,027 S1112G probably benign Het
Impg2 A T 16: 56,231,460 S242C probably damaging Het
Itgb1 T A 8: 128,707,106 S34T probably benign Het
Kcnh8 A G 17: 52,898,514 I546V probably damaging Het
Klrd1 T G 6: 129,591,832 M1R probably null Het
Krtap16-1 A T 11: 99,985,818 C253* probably null Het
Mapk7 A G 11: 61,493,709 I57T possibly damaging Het
Msrb2 A G 2: 19,383,262 N74D probably benign Het
Myd88 A T 9: 119,339,707 S85T probably benign Het
Myo1c G T 11: 75,650,611 probably benign Het
Nap1l3 C A X: 122,396,814 S69I unknown Het
Nnt T A 13: 119,357,524 N674Y unknown Het
Nrcam A G 12: 44,573,824 Y878C probably damaging Het
Obscn T C 11: 59,132,566 T662A probably benign Het
Olfr1090 A G 2: 86,753,938 S267P possibly damaging Het
Olfr115 T C 17: 37,610,517 Q78R probably benign Het
Olfr615 A G 7: 103,560,575 S33G probably benign Het
Olfr724 A G 14: 49,960,424 V216A probably benign Het
Pappa2 C A 1: 158,936,193 V583L probably damaging Het
Parp1 T G 1: 180,588,115 S500A probably benign Het
Pcdhb17 A G 18: 37,486,936 D593G probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Prrc1 C G 18: 57,363,199 S74W possibly damaging Het
Rag2 G A 2: 101,630,074 G243D probably damaging Het
Sgpp1 T C 12: 75,735,187 E126G probably damaging Het
Skiv2l G A 17: 34,845,222 T496M probably benign Het
Slc17a1 C A 13: 23,880,449 F329L probably benign Het
Slc52a3 G A 2: 152,004,592 V158I probably benign Het
Slf1 T A 13: 77,125,456 T75S possibly damaging Het
Smok2b G A 17: 13,234,750 probably null Het
Tmem125 A T 4: 118,541,892 V114E probably damaging Het
Ube2f A T 1: 91,254,258 probably benign Het
Zdhhc19 T A 16: 32,497,174 F30I probably damaging Het
Zfp462 C A 4: 55,009,595 Y520* probably null Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACCCAGACCTCAGTGTTCTG -3'
(R):5'- TCTCAGGGTGTACCGATGTTC -3'

Sequencing Primer
(F):5'- GACAGTTGTATAGACCATTTCGTGCC -3'
(R):5'- CCTGAGGTTCTGATAAAGATGTCATC -3'
Posted On 2022-03-25