Incidental Mutation 'R0761:Olfr137'
ID70109
Institutional Source Beutler Lab
Gene Symbol Olfr137
Ensembl Gene ENSMUSG00000054940
Gene Nameolfactory receptor 137
SynonymsMOR256-18, GA_x6K02T2PSCP-2749525-2748587
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38303527-38307570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38305391 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 23 (H23Q)
Ref Sequence ENSEMBL: ENSMUSP00000150173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057394] [ENSMUST00000213505]
Predicted Effect probably benign
Transcript: ENSMUST00000057394
AA Change: H23Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051537
Gene: ENSMUSG00000054940
AA Change: H23Q

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4e-49 PFAM
Pfam:7tm_1 42 291 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213505
AA Change: H23Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nudt12 A T 17: 59,011,069 D60E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Olfr137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Olfr137 APN 17 38304648 missense probably benign 0.03
IGL03169:Olfr137 APN 17 38305101 missense probably damaging 1.00
IGL03392:Olfr137 APN 17 38304895 missense probably benign 0.02
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0496:Olfr137 UTSW 17 38304658 missense probably damaging 0.99
R1126:Olfr137 UTSW 17 38304688 missense probably damaging 0.97
R1835:Olfr137 UTSW 17 38305312 missense probably benign 0.02
R3727:Olfr137 UTSW 17 38305419 missense possibly damaging 0.64
R5556:Olfr137 UTSW 17 38305073 missense possibly damaging 0.71
R5979:Olfr137 UTSW 17 38305192 missense probably benign
R6430:Olfr137 UTSW 17 38305358 missense probably benign 0.04
R6433:Olfr137 UTSW 17 38305413 missense probably damaging 1.00
R7400:Olfr137 UTSW 17 38305331 missense possibly damaging 0.91
R8053:Olfr137 UTSW 17 38305210 missense probably benign
R8199:Olfr137 UTSW 17 38304553 missense probably benign 0.31
R8446:Olfr137 UTSW 17 38304747 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGGTCATAGGACATCACCACCA -3'
(R):5'- AATTGTTTGCTTTCACCACTCATCAGC -3'

Sequencing Primer
(F):5'- GGCCCCAGAGGTTAAATAGC -3'
(R):5'- TTTCACCACTCATCAGCTTTTC -3'
Posted On2013-09-30