Incidental Mutation 'R9243:Grik3'
ID 701091
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9243 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 125490700-125714173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 125707897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 856 (R856C)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably benign
Transcript: ENSMUST00000030676
AA Change: R856C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: R856C

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,141,252 S1816R probably benign Het
Appl1 A T 14: 26,927,753 F605L possibly damaging Het
Cacna1g T A 11: 94,457,067 I732F possibly damaging Het
Capg T A 6: 72,561,087 S319T probably benign Het
Cdh17 T A 4: 11,771,333 F38L probably benign Het
Cep295 T A 9: 15,332,309 N1617I probably benign Het
Cep57 C T 9: 13,826,908 probably benign Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
Dock7 A G 4: 98,969,634 V1481A unknown Het
Exoc2 T C 13: 30,925,795 K197E probably benign Het
Fancg C T 4: 43,006,565 V330I possibly damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gad2 A G 2: 22,635,041 E279G possibly damaging Het
Gria1 A G 11: 57,238,062 Y454C probably benign Het
Hdac4 C A 1: 91,972,789 R622I probably damaging Het
Hdac4 T C 1: 91,972,790 R622G probably benign Het
Idh1 A G 1: 65,168,497 probably null Het
Igf1r A G 7: 68,212,027 S1112G probably benign Het
Impg2 A T 16: 56,231,460 S242C probably damaging Het
Itgb1 T A 8: 128,707,106 S34T probably benign Het
Kcnh8 A G 17: 52,898,514 I546V probably damaging Het
Klrd1 T G 6: 129,591,832 M1R probably null Het
Krtap16-1 A T 11: 99,985,818 C253* probably null Het
Mapk7 A G 11: 61,493,709 I57T possibly damaging Het
Msrb2 A G 2: 19,383,262 N74D probably benign Het
Myd88 A T 9: 119,339,707 S85T probably benign Het
Myo1c G T 11: 75,650,611 probably benign Het
Nap1l3 C A X: 122,396,814 S69I unknown Het
Nnt T A 13: 119,357,524 N674Y unknown Het
Nrcam A G 12: 44,573,824 Y878C probably damaging Het
Obscn T C 11: 59,132,566 T662A probably benign Het
Olfr1090 A G 2: 86,753,938 S267P possibly damaging Het
Olfr115 T C 17: 37,610,517 Q78R probably benign Het
Olfr615 A G 7: 103,560,575 S33G probably benign Het
Olfr724 A G 14: 49,960,424 V216A probably benign Het
Pappa2 C A 1: 158,936,193 V583L probably damaging Het
Parp1 T G 1: 180,588,115 S500A probably benign Het
Pcdhb17 A G 18: 37,486,936 D593G probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Prrc1 C G 18: 57,363,199 S74W possibly damaging Het
Rag2 G A 2: 101,630,074 G243D probably damaging Het
Sgpp1 T C 12: 75,735,187 E126G probably damaging Het
Skiv2l G A 17: 34,845,222 T496M probably benign Het
Slc17a1 C A 13: 23,880,449 F329L probably benign Het
Slc52a3 G A 2: 152,004,592 V158I probably benign Het
Slf1 T A 13: 77,125,456 T75S possibly damaging Het
Smok2b G A 17: 13,234,750 probably null Het
Tmem125 A T 4: 118,541,892 V114E probably damaging Het
Ube2f A T 1: 91,254,258 probably benign Het
Zdhhc19 T A 16: 32,497,174 F30I probably damaging Het
Zfp462 C A 4: 55,009,595 Y520* probably null Het
Zzz3 A G 3: 152,428,283 D326G probably damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7822:Grik3 UTSW 4 125656397 critical splice donor site probably null
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8418:Grik3 UTSW 4 125686042 missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125656373 missense probably damaging 1.00
R9030:Grik3 UTSW 4 125632392 missense probably benign 0.24
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGTTTAGGCTGCTGTGAAAC -3'
(R):5'- CAGCACGAGATGAGGATGTC -3'

Sequencing Primer
(F):5'- TGTGAAACAGAAAGATGATGCC -3'
(R):5'- ACGAGATGAGGATGTCCGTCC -3'
Posted On 2022-03-25