Incidental Mutation 'R0761:Nudt12'
ID70111
Institutional Source Beutler Lab
Gene Symbol Nudt12
Ensembl Gene ENSMUSG00000024228
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 12
Synonyms
MMRRC Submission 038941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0761 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location58999618-59013372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59011069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 60 (D60E)
Ref Sequence ENSEMBL: ENSMUSP00000133678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025065] [ENSMUST00000174122]
Predicted Effect probably benign
Transcript: ENSMUST00000025065
AA Change: D60E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025065
Gene: ENSMUSG00000024228
AA Change: D60E

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 3.2e-10 PFAM
Pfam:zf-NADH-PPase 279 309 2.7e-10 PFAM
Pfam:NUDIX 322 447 8.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152750
Predicted Effect probably benign
Transcript: ENSMUST00000174122
AA Change: D60E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133678
Gene: ENSMUSG00000024228
AA Change: D60E

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 2.4e-9 PFAM
Pfam:zf-NADH-PPase 279 311 5.9e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotides are involved in numerous biochemical reactions and pathways within the cell as substrates, cofactors, and effectors. Nudix hydrolases, such as NUDT12, regulate the concentrations of individual nucleotides and of nucleotide ratios in response to changing circumstances (Abdelraheim et al., 2003 [PubMed 12790796]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,999 Y133C probably benign Het
Adcy5 G A 16: 35,270,825 probably benign Het
Asb17 A G 3: 153,844,415 K28R probably damaging Het
Bbs10 G T 10: 111,299,383 C119F probably damaging Het
Camk2g G A 14: 20,766,212 Q119* probably null Het
Cdh18 A T 15: 23,226,752 I46L possibly damaging Het
Clmn T A 12: 104,781,558 N577Y probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crocc T C 4: 141,029,776 T965A probably benign Het
Crocc T C 4: 141,047,076 E63G probably benign Het
Cryzl2 A G 1: 157,465,724 I132V probably benign Het
Csgalnact2 T C 6: 118,126,112 probably benign Het
Ctr9 T C 7: 111,046,272 S569P probably damaging Het
Cul3 A G 1: 80,277,486 probably benign Het
Dcp2 G A 18: 44,410,233 S286N probably benign Het
Dgkz C T 2: 91,945,351 R189H probably benign Het
Dst A G 1: 34,182,767 T2551A probably benign Het
Fam166a T C 2: 25,220,123 probably benign Het
Gm14548 A T 7: 3,893,979 probably null Het
Kcna4 T A 2: 107,296,072 S384T probably benign Het
Klhl17 T C 4: 156,232,747 probably null Het
Kmt2e C A 5: 23,503,034 S1865* probably null Het
L3mbtl1 G A 2: 162,966,047 R534H probably damaging Het
Lmnb2 A T 10: 80,906,254 M1K probably null Het
Lrp1b T C 2: 41,185,935 D1784G probably damaging Het
Lrrc34 A G 3: 30,631,276 probably null Het
Megf10 C A 18: 57,287,976 Y895* probably null Het
Mesd G T 7: 83,895,743 A143S probably damaging Het
Mfap3l G T 8: 60,671,581 V286L possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nek1 T A 8: 61,089,455 D717E probably benign Het
Nup205 C T 6: 35,196,428 probably benign Het
Olfr1152 C T 2: 87,868,536 P182S possibly damaging Het
Olfr1248 T C 2: 89,617,835 D119G probably damaging Het
Olfr137 A T 17: 38,305,391 H23Q probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pacs2 T A 12: 113,060,068 probably benign Het
Pcdha9 T A 18: 36,999,963 L695* probably null Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Polr1e C A 4: 45,027,392 D207E probably damaging Het
Polr3f T A 2: 144,534,407 V142E probably damaging Het
Psma6 T A 12: 55,412,342 W170R possibly damaging Het
Rev3l T C 10: 39,874,195 Y3114H probably benign Het
Rps6ka5 C T 12: 100,570,882 A530T probably damaging Het
Simc1 T C 13: 54,526,574 Y912H probably damaging Het
Tnfrsf1b T C 4: 145,216,100 D371G possibly damaging Het
Trank1 T C 9: 111,366,613 V1235A probably damaging Het
Ttn T C 2: 76,746,758 E24597G probably damaging Het
Ubr2 G A 17: 46,983,316 P297L probably damaging Het
Unc5d A T 8: 28,696,532 probably null Het
Xpo4 A G 14: 57,613,383 F355L probably damaging Het
Other mutations in Nudt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02860:Nudt12 APN 17 59010435 missense probably benign 0.01
IGL02904:Nudt12 APN 17 59010352 missense probably benign 0.00
IGL03206:Nudt12 APN 17 59007672 missense probably benign 0.00
R0121:Nudt12 UTSW 17 59007639 missense possibly damaging 0.80
R0673:Nudt12 UTSW 17 59007622 critical splice donor site probably null
R1079:Nudt12 UTSW 17 59011037 splice site probably benign
R1277:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1815:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1816:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1834:Nudt12 UTSW 17 59011076 missense probably damaging 1.00
R2296:Nudt12 UTSW 17 59010049 missense possibly damaging 0.85
R2415:Nudt12 UTSW 17 59006608 missense probably damaging 0.99
R5011:Nudt12 UTSW 17 58996504 unclassified probably benign
R5384:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5385:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5874:Nudt12 UTSW 17 59010284 nonsense probably null
R6108:Nudt12 UTSW 17 59007749 missense probably damaging 1.00
R6477:Nudt12 UTSW 17 59011145 missense probably benign 0.12
R7030:Nudt12 UTSW 17 59003353 missense probably benign 0.22
R7592:Nudt12 UTSW 17 59006594 missense probably benign 0.02
R8252:Nudt12 UTSW 17 59011094 missense probably damaging 0.99
Z1177:Nudt12 UTSW 17 59011071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTTAGTGACAAATCAGGCCCC -3'
(R):5'- TGCTGCCTTTCCAAGATCAGCATC -3'

Sequencing Primer
(F):5'- GGCCCCCTTTCATATAATAAACTGG -3'
(R):5'- CAGGAATACTCAGCCATTCTCCA -3'
Posted On2013-09-30