Incidental Mutation 'R9243:Kcnh8'
ID 701121
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, Kv12.1, C130090D05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9243 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 52909737-53286222 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53205542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 546 (I546V)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: I546V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: I546V

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,188,035 (GRCm39) S1816R probably benign Het
Appl1 A T 14: 26,649,710 (GRCm39) F605L possibly damaging Het
Cacna1g T A 11: 94,347,893 (GRCm39) I732F possibly damaging Het
Capg T A 6: 72,538,070 (GRCm39) S319T probably benign Het
Cdh17 T A 4: 11,771,333 (GRCm39) F38L probably benign Het
Cep295 T A 9: 15,243,605 (GRCm39) N1617I probably benign Het
Cep57 C T 9: 13,738,204 (GRCm39) probably benign Het
Cfap46 A T 7: 139,195,265 (GRCm39) probably benign Het
Csnk1g2 C A 10: 80,475,648 (GRCm39) A405E probably damaging Het
Dock7 A G 4: 98,857,871 (GRCm39) V1481A unknown Het
Exoc2 T C 13: 31,109,778 (GRCm39) K197E probably benign Het
Fancg C T 4: 43,006,565 (GRCm39) V330I possibly damaging Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Gad2 A G 2: 22,525,053 (GRCm39) E279G possibly damaging Het
Gria1 A G 11: 57,128,888 (GRCm39) Y454C probably benign Het
Grik3 C T 4: 125,601,690 (GRCm39) R856C probably benign Het
Hdac4 C A 1: 91,900,511 (GRCm39) R622I probably damaging Het
Hdac4 T C 1: 91,900,512 (GRCm39) R622G probably benign Het
Htt T C 5: 35,056,276 (GRCm39) probably benign Het
Idh1 A G 1: 65,207,656 (GRCm39) probably null Het
Igf1r A G 7: 67,861,775 (GRCm39) S1112G probably benign Het
Impg2 A T 16: 56,051,823 (GRCm39) S242C probably damaging Het
Itgb1 T A 8: 129,433,587 (GRCm39) S34T probably benign Het
Klrd1 T G 6: 129,568,795 (GRCm39) M1R probably null Het
Krtap16-1 A T 11: 99,876,644 (GRCm39) C253* probably null Het
Mapk7 A G 11: 61,384,535 (GRCm39) I57T possibly damaging Het
Msrb2 A G 2: 19,388,073 (GRCm39) N74D probably benign Het
Myd88 A T 9: 119,168,773 (GRCm39) S85T probably benign Het
Myo1c G T 11: 75,541,437 (GRCm39) probably benign Het
Nnt T A 13: 119,494,060 (GRCm39) N674Y unknown Het
Nrcam A G 12: 44,620,607 (GRCm39) Y878C probably damaging Het
Obscn T C 11: 59,023,392 (GRCm39) T662A probably benign Het
Or14j4 T C 17: 37,921,408 (GRCm39) Q78R probably benign Het
Or4l15 A G 14: 50,197,881 (GRCm39) V216A probably benign Het
Or51ah3 A G 7: 103,209,782 (GRCm39) S33G probably benign Het
Or8k40 A G 2: 86,584,282 (GRCm39) S267P possibly damaging Het
Pappa2 C A 1: 158,763,763 (GRCm39) V583L probably damaging Het
Parp1 T G 1: 180,415,680 (GRCm39) S500A probably benign Het
Pcdhb17 A G 18: 37,619,989 (GRCm39) D593G probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Prrc1 C G 18: 57,496,271 (GRCm39) S74W possibly damaging Het
Rag2 G A 2: 101,460,419 (GRCm39) G243D probably damaging Het
Sgpp1 T C 12: 75,781,961 (GRCm39) E126G probably damaging Het
Skic2 G A 17: 35,064,198 (GRCm39) T496M probably benign Het
Slc17a1 C A 13: 24,064,432 (GRCm39) F329L probably benign Het
Slc52a3 G A 2: 151,846,512 (GRCm39) V158I probably benign Het
Slf1 T A 13: 77,273,575 (GRCm39) T75S possibly damaging Het
Smok2b G A 17: 13,453,637 (GRCm39) probably null Het
Tmem125 A T 4: 118,399,089 (GRCm39) V114E probably damaging Het
Ube2f A T 1: 91,181,980 (GRCm39) probably benign Het
Zdhhc19 T A 16: 32,315,992 (GRCm39) F30I probably damaging Het
Zfp236 T C 18: 82,662,050 (GRCm39) probably benign Het
Zfp462 C A 4: 55,009,595 (GRCm39) Y520* probably null Het
Zzz3 A G 3: 152,133,920 (GRCm39) D326G probably damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 53,141,708 (GRCm39) missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 53,201,148 (GRCm39) splice site probably benign
IGL01959:Kcnh8 APN 17 53,141,635 (GRCm39) missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 53,184,939 (GRCm39) missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 53,110,556 (GRCm39) missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 53,205,525 (GRCm39) missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 53,266,471 (GRCm39) missense probably benign 0.00
IGL02931:Kcnh8 APN 17 53,263,650 (GRCm39) missense probably benign 0.00
IGL02950:Kcnh8 APN 17 53,263,795 (GRCm39) missense probably benign 0.22
Incompetent UTSW 17 53,201,129 (GRCm39) missense probably damaging 1.00
leak UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R0282:Kcnh8 UTSW 17 53,032,879 (GRCm39) missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 53,284,648 (GRCm39) splice site probably null
R0496:Kcnh8 UTSW 17 53,032,886 (GRCm39) missense probably benign 0.19
R0601:Kcnh8 UTSW 17 53,201,033 (GRCm39) missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 53,285,141 (GRCm39) nonsense probably null
R0891:Kcnh8 UTSW 17 53,212,242 (GRCm39) missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 53,032,927 (GRCm39) missense probably benign 0.00
R1054:Kcnh8 UTSW 17 53,110,512 (GRCm39) missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 53,200,989 (GRCm39) missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 53,200,988 (GRCm39) missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 53,263,909 (GRCm39) missense probably benign
R1657:Kcnh8 UTSW 17 53,146,153 (GRCm39) missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 53,200,996 (GRCm39) missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 53,200,961 (GRCm39) missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1804:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1929:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1980:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1981:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R1982:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2016:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2017:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2132:Kcnh8 UTSW 17 53,200,961 (GRCm39) missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 53,200,961 (GRCm39) missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2265:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2266:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2267:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2303:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2309:Kcnh8 UTSW 17 53,285,067 (GRCm39) missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2764:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2857:Kcnh8 UTSW 17 53,284,961 (GRCm39) missense probably benign
R2898:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R2987:Kcnh8 UTSW 17 53,263,763 (GRCm39) missense probably benign 0.05
R3031:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R3157:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R3158:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4080:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4081:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4082:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4087:Kcnh8 UTSW 17 53,110,428 (GRCm39) missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4158:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4213:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4301:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4302:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4383:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4385:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4400:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4490:Kcnh8 UTSW 17 53,268,905 (GRCm39) critical splice donor site probably null
R4493:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4494:Kcnh8 UTSW 17 53,032,934 (GRCm39) small deletion probably benign
R4611:Kcnh8 UTSW 17 52,909,864 (GRCm39) missense probably benign 0.22
R4728:Kcnh8 UTSW 17 53,032,898 (GRCm39) missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 53,212,248 (GRCm39) splice site probably null
R4927:Kcnh8 UTSW 17 53,185,009 (GRCm39) missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 53,184,995 (GRCm39) missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 53,200,958 (GRCm39) missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 53,205,486 (GRCm39) missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 53,212,043 (GRCm39) missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 53,033,023 (GRCm39) missense probably benign 0.10
R5472:Kcnh8 UTSW 17 53,284,844 (GRCm39) missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 53,033,008 (GRCm39) missense probably benign 0.00
R5714:Kcnh8 UTSW 17 53,285,150 (GRCm39) missense probably benign 0.31
R5866:Kcnh8 UTSW 17 53,263,804 (GRCm39) missense probably benign 0.05
R5903:Kcnh8 UTSW 17 53,110,364 (GRCm39) missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 53,184,971 (GRCm39) nonsense probably null
R6994:Kcnh8 UTSW 17 53,284,723 (GRCm39) missense probably benign 0.02
R7101:Kcnh8 UTSW 17 53,212,038 (GRCm39) missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 53,201,145 (GRCm39) splice site probably null
R7228:Kcnh8 UTSW 17 53,263,744 (GRCm39) missense probably benign 0.01
R7372:Kcnh8 UTSW 17 53,201,129 (GRCm39) missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 53,268,871 (GRCm39) missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 53,263,743 (GRCm39) missense probably benign
R7952:Kcnh8 UTSW 17 53,266,493 (GRCm39) missense probably benign 0.02
R8176:Kcnh8 UTSW 17 53,285,122 (GRCm39) missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 53,263,936 (GRCm39) missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 53,212,101 (GRCm39) missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 53,285,320 (GRCm39) missense probably benign
R8716:Kcnh8 UTSW 17 53,284,780 (GRCm39) missense probably benign 0.02
R8943:Kcnh8 UTSW 17 53,104,486 (GRCm39) missense probably benign 0.00
R9051:Kcnh8 UTSW 17 53,141,642 (GRCm39) missense probably damaging 1.00
R9211:Kcnh8 UTSW 17 53,146,236 (GRCm39) missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 53,285,168 (GRCm39) missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 53,146,084 (GRCm39) missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 53,185,089 (GRCm39) missense probably damaging 1.00
R9646:Kcnh8 UTSW 17 53,104,573 (GRCm39) missense probably benign 0.25
RF009:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF010:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF011:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF021:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
RF022:Kcnh8 UTSW 17 53,285,267 (GRCm39) missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 53,285,320 (GRCm39) missense probably benign
Z1088:Kcnh8 UTSW 17 53,032,918 (GRCm39) missense probably damaging 1.00
Z1176:Kcnh8 UTSW 17 53,201,089 (GRCm39) missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 53,285,121 (GRCm39) missense possibly damaging 0.91
Z1177:Kcnh8 UTSW 17 53,110,499 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCCCTGGAGATTGTACAGAG -3'
(R):5'- CAACACCATGCTGTCTTTAAGAAC -3'

Sequencing Primer
(F):5'- AACAGCCTACTCTTGTATAGTGCAG -3'
(R):5'- TTAAGAACTTCCATAGAGCCTGAGC -3'
Posted On 2022-03-25