Incidental Mutation 'R9243:Kcnh8'
ID 701121
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, C130090D05Rik, Kv12.1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9243 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 52602709-52979194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52898514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 546 (I546V)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: I546V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: I546V

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,141,252 S1816R probably benign Het
Appl1 A T 14: 26,927,753 F605L possibly damaging Het
Cacna1g T A 11: 94,457,067 I732F possibly damaging Het
Capg T A 6: 72,561,087 S319T probably benign Het
Cdh17 T A 4: 11,771,333 F38L probably benign Het
Cep295 T A 9: 15,332,309 N1617I probably benign Het
Cep57 C T 9: 13,826,908 probably benign Het
Cfap46 A T 7: 139,615,349 probably benign Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
Dock7 A G 4: 98,969,634 V1481A unknown Het
Exoc2 T C 13: 30,925,795 K197E probably benign Het
Fancg C T 4: 43,006,565 V330I possibly damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gad2 A G 2: 22,635,041 E279G possibly damaging Het
Gria1 A G 11: 57,238,062 Y454C probably benign Het
Grik3 C T 4: 125,707,897 R856C probably benign Het
Hdac4 C A 1: 91,972,789 R622I probably damaging Het
Hdac4 T C 1: 91,972,790 R622G probably benign Het
Htt T C 5: 34,898,932 probably benign Het
Idh1 A G 1: 65,168,497 probably null Het
Igf1r A G 7: 68,212,027 S1112G probably benign Het
Impg2 A T 16: 56,231,460 S242C probably damaging Het
Itgb1 T A 8: 128,707,106 S34T probably benign Het
Klrd1 T G 6: 129,591,832 M1R probably null Het
Krtap16-1 A T 11: 99,985,818 C253* probably null Het
Mapk7 A G 11: 61,493,709 I57T possibly damaging Het
Msrb2 A G 2: 19,383,262 N74D probably benign Het
Myd88 A T 9: 119,339,707 S85T probably benign Het
Myo1c G T 11: 75,650,611 probably benign Het
Nnt T A 13: 119,357,524 N674Y unknown Het
Nrcam A G 12: 44,573,824 Y878C probably damaging Het
Obscn T C 11: 59,132,566 T662A probably benign Het
Olfr1090 A G 2: 86,753,938 S267P possibly damaging Het
Olfr115 T C 17: 37,610,517 Q78R probably benign Het
Olfr615 A G 7: 103,560,575 S33G probably benign Het
Olfr724 A G 14: 49,960,424 V216A probably benign Het
Pappa2 C A 1: 158,936,193 V583L probably damaging Het
Parp1 T G 1: 180,588,115 S500A probably benign Het
Pcdhb17 A G 18: 37,486,936 D593G probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Prrc1 C G 18: 57,363,199 S74W possibly damaging Het
Rag2 G A 2: 101,630,074 G243D probably damaging Het
Sgpp1 T C 12: 75,735,187 E126G probably damaging Het
Skiv2l G A 17: 34,845,222 T496M probably benign Het
Slc17a1 C A 13: 23,880,449 F329L probably benign Het
Slc52a3 G A 2: 152,004,592 V158I probably benign Het
Slf1 T A 13: 77,125,456 T75S possibly damaging Het
Smok2b G A 17: 13,234,750 probably null Het
Tmem125 A T 4: 118,541,892 V114E probably damaging Het
Ube2f A T 1: 91,254,258 probably benign Het
Zdhhc19 T A 16: 32,497,174 F30I probably damaging Het
Zfp236 T C 18: 82,643,925 probably benign Het
Zfp462 C A 4: 55,009,595 Y520* probably null Het
Zzz3 A G 3: 152,428,283 D326G probably damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
R7952:Kcnh8 UTSW 17 52959465 missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52978094 missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52956908 missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52905073 missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52978292 missense probably benign
R8716:Kcnh8 UTSW 17 52977752 missense probably benign 0.02
R8943:Kcnh8 UTSW 17 52797458 missense probably benign 0.00
R9051:Kcnh8 UTSW 17 52834614 missense probably damaging 1.00
R9211:Kcnh8 UTSW 17 52839208 missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 52978140 missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 52839056 missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 52878061 missense probably damaging 1.00
R9646:Kcnh8 UTSW 17 52797545 missense probably benign 0.25
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATAGCCCTGGAGATTGTACAGAG -3'
(R):5'- CAACACCATGCTGTCTTTAAGAAC -3'

Sequencing Primer
(F):5'- AACAGCCTACTCTTGTATAGTGCAG -3'
(R):5'- TTAAGAACTTCCATAGAGCCTGAGC -3'
Posted On 2022-03-25