Incidental Mutation 'R9244:Gm15448'
ID 701152
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Name predicted gene 15448
Synonyms ENSMUSG00000074419
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R9244 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 3816781-3825687 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3822227 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 472 (D472G)
Ref Sequence ENSEMBL: ENSMUSP00000121707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
AlphaFold F6PZL4
Predicted Effect probably benign
Transcript: ENSMUST00000094911
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: D472G

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108620
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153846
AA Change: D472G
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: D472G

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189095
AA Change: D472G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: D472G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,700 Y207C probably damaging Het
Abca13 A G 11: 9,291,577 I1147V probably benign Het
Adcy10 A G 1: 165,543,110 T653A probably benign Het
App A G 16: 84,962,741 I656T probably damaging Het
Arnt T A 3: 95,490,568 I574N possibly damaging Het
Cdc42 T C 4: 137,329,080 T75A probably benign Het
Cdh23 C A 10: 60,413,663 K822N possibly damaging Het
Chrnb3 T A 8: 27,394,566 L444I unknown Het
Ctnnbl1 G T 2: 157,836,663 K395N possibly damaging Het
Dmxl1 T A 18: 49,893,249 I1808K probably benign Het
Dnajb8 C A 6: 88,222,902 P140Q probably damaging Het
Dock5 G A 14: 67,759,114 R1727W probably damaging Het
Dscam G A 16: 96,685,229 T1082I possibly damaging Het
Enpp3 T C 10: 24,778,791 D663G probably damaging Het
Epha5 A G 5: 84,117,582 V451A probably benign Het
Erap1 G A 13: 74,673,784 probably null Het
Esco2 A G 14: 65,821,639 W530R probably damaging Het
Fam160a2 A G 7: 105,389,663 V123A possibly damaging Het
Fhod3 T C 18: 25,115,865 I1367T probably damaging Het
Gm42669 A G 5: 107,508,504 T295A possibly damaging Het
Harbi1 A G 2: 91,712,695 N167S probably damaging Het
Hfm1 A C 5: 106,874,900 N945K probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Htr1f G T 16: 64,926,494 T145K probably benign Het
Igf2bp2 A C 16: 22,068,151 S453A possibly damaging Het
Ipo4 A T 14: 55,634,342 W116R probably damaging Het
Jak1 T C 4: 101,157,843 H917R probably benign Het
Klrb1b A T 6: 128,815,282 C189* probably null Het
Lrrn2 A G 1: 132,937,320 Y41C probably damaging Het
Lrrn2 T C 1: 132,937,499 S101P probably damaging Het
Mcmdc2 C T 1: 9,915,610 T127I probably damaging Het
Ndufb5 C A 3: 32,741,757 Q33K probably null Het
Nufip2 T C 11: 77,692,649 V463A probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1062 A T 2: 86,423,079 V199E probably damaging Het
Olfr212 G A 6: 116,515,821 V15I probably benign Het
Olfr457 T A 6: 42,471,603 I192F possibly damaging Het
Olfr486 A G 7: 108,172,645 I33T probably benign Het
Ppip5k1 A C 2: 121,334,451 S972A probably benign Het
Prl8a2 A T 13: 27,350,999 M86L probably benign Het
Prorsd1 T C 11: 29,513,271 I164V probably benign Het
Ptgs1 A G 2: 36,240,712 T208A probably damaging Het
Ptpn3 A T 4: 57,254,915 probably null Het
Reln T C 5: 21,915,153 R2834G probably damaging Het
Shc4 G T 2: 125,655,669 Y373* probably null Het
Skor1 A T 9: 63,142,242 probably null Het
Slc9a4 T C 1: 40,619,089 S591P probably damaging Het
Stat2 A G 10: 128,282,765 E389G possibly damaging Het
Trav14n-3 C A 14: 53,370,547 D111E probably damaging Het
Unc5c A G 3: 141,827,609 S873G probably benign Het
Vmn1r210 T C 13: 22,827,919 I66V probably benign Het
Vmn2r117 T A 17: 23,477,615 I273F probably damaging Het
Vmn2r95 T A 17: 18,451,927 M714K possibly damaging Het
Wrb A G 16: 96,154,183 T147A probably benign Het
Zfp235 A G 7: 24,140,494 T113A probably benign Het
Zranb1 T G 7: 132,983,911 L696R probably damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
R8441:Gm15448 UTSW 7 3823302 nonsense probably null
R8739:Gm15448 UTSW 7 3825189 missense
R8785:Gm15448 UTSW 7 3816929 missense unknown
R8912:Gm15448 UTSW 7 3822819 missense unknown
R8941:Gm15448 UTSW 7 3822381 missense probably damaging 1.00
R8990:Gm15448 UTSW 7 3821274 missense unknown
R9049:Gm15448 UTSW 7 3816891 missense unknown
R9090:Gm15448 UTSW 7 3816998 missense unknown
R9134:Gm15448 UTSW 7 3822183 missense
R9136:Gm15448 UTSW 7 3823286 missense
R9271:Gm15448 UTSW 7 3816998 missense unknown
R9328:Gm15448 UTSW 7 3824581 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTGACAGAGTCTGTTAAGC -3'
(R):5'- TCGAACACAGCCCTGATTGG -3'

Sequencing Primer
(F):5'- GTTAAGCTACTCACCTGGGATCAG -3'
(R):5'- AAACCTCAGTCTCTAGCTGTCAC -3'
Posted On 2022-03-25