Incidental Mutation 'R9244:Olfr486'
ID 701155
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Name olfactory receptor 486
Synonyms MOR204-19, GA_x6K02T2PBJ9-10501920-10500976
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9244 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 108171798-108172742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108172645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 33 (I33T)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
AlphaFold Q8VFD0
Predicted Effect probably benign
Transcript: ENSMUST00000072035
AA Change: I33T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: I33T

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,700 Y207C probably damaging Het
Abca13 A G 11: 9,291,577 I1147V probably benign Het
Adcy10 A G 1: 165,543,110 T653A probably benign Het
App A G 16: 84,962,741 I656T probably damaging Het
Arnt T A 3: 95,490,568 I574N possibly damaging Het
Cdc42 T C 4: 137,329,080 T75A probably benign Het
Cdh23 C A 10: 60,413,663 K822N possibly damaging Het
Chrnb3 T A 8: 27,394,566 L444I unknown Het
Ctnnbl1 G T 2: 157,836,663 K395N possibly damaging Het
Dmxl1 T A 18: 49,893,249 I1808K probably benign Het
Dnajb8 C A 6: 88,222,902 P140Q probably damaging Het
Dock5 G A 14: 67,759,114 R1727W probably damaging Het
Dscam G A 16: 96,685,229 T1082I possibly damaging Het
Enpp3 T C 10: 24,778,791 D663G probably damaging Het
Epha5 A G 5: 84,117,582 V451A probably benign Het
Erap1 G A 13: 74,673,784 probably null Het
Esco2 A G 14: 65,821,639 W530R probably damaging Het
Fam160a2 A G 7: 105,389,663 V123A possibly damaging Het
Fhod3 T C 18: 25,115,865 I1367T probably damaging Het
Gm15448 T C 7: 3,822,227 D472G unknown Het
Gm42669 A G 5: 107,508,504 T295A possibly damaging Het
Harbi1 A G 2: 91,712,695 N167S probably damaging Het
Hfm1 A C 5: 106,874,900 N945K probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Htr1f G T 16: 64,926,494 T145K probably benign Het
Igf2bp2 A C 16: 22,068,151 S453A possibly damaging Het
Ipo4 A T 14: 55,634,342 W116R probably damaging Het
Jak1 T C 4: 101,157,843 H917R probably benign Het
Klrb1b A T 6: 128,815,282 C189* probably null Het
Lrrn2 A G 1: 132,937,320 Y41C probably damaging Het
Lrrn2 T C 1: 132,937,499 S101P probably damaging Het
Mcmdc2 C T 1: 9,915,610 T127I probably damaging Het
Ndufb5 C A 3: 32,741,757 Q33K probably null Het
Nufip2 T C 11: 77,692,649 V463A probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1062 A T 2: 86,423,079 V199E probably damaging Het
Olfr212 G A 6: 116,515,821 V15I probably benign Het
Olfr457 T A 6: 42,471,603 I192F possibly damaging Het
Ppip5k1 A C 2: 121,334,451 S972A probably benign Het
Prl8a2 A T 13: 27,350,999 M86L probably benign Het
Prorsd1 T C 11: 29,513,271 I164V probably benign Het
Ptgs1 A G 2: 36,240,712 T208A probably damaging Het
Ptpn3 A T 4: 57,254,915 probably null Het
Reln T C 5: 21,915,153 R2834G probably damaging Het
Shc4 G T 2: 125,655,669 Y373* probably null Het
Skor1 A T 9: 63,142,242 probably null Het
Slc9a4 T C 1: 40,619,089 S591P probably damaging Het
Stat2 A G 10: 128,282,765 E389G possibly damaging Het
Trav14n-3 C A 14: 53,370,547 D111E probably damaging Het
Unc5c A G 3: 141,827,609 S873G probably benign Het
Vmn1r210 T C 13: 22,827,919 I66V probably benign Het
Vmn2r117 T A 17: 23,477,615 I273F probably damaging Het
Vmn2r95 T A 17: 18,451,927 M714K possibly damaging Het
Wrb A G 16: 96,154,183 T147A probably benign Het
Zfp235 A G 7: 24,140,494 T113A probably benign Het
Zranb1 T G 7: 132,983,911 L696R probably damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Olfr486 UTSW 7 108171927 missense probably benign 0.09
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0165:Olfr486 UTSW 7 108172675 missense probably benign 0.03
R0739:Olfr486 UTSW 7 108172010 missense probably benign 0.00
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
R7499:Olfr486 UTSW 7 108171800 makesense probably null
R7894:Olfr486 UTSW 7 108172184 missense probably benign
R7995:Olfr486 UTSW 7 108172000 missense probably damaging 1.00
R8807:Olfr486 UTSW 7 108172645 missense possibly damaging 0.93
R9050:Olfr486 UTSW 7 108171880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAAGTTGACAAGCATATTGG -3'
(R):5'- ATGTGTCTGAAGAGAGTGATGC -3'

Sequencing Primer
(F):5'- TGACAAGCATATTGGGTGTGAC -3'
(R):5'- GTGAGTTCCAAGAATCAAACTCTGG -3'
Posted On 2022-03-25