Mutagenetix > Incidental Mutation

Incidental Mutation 'R9244:Hook3'

701157

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9244 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 26071056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

probably null
Transcript: ENSMUST00000037182

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210172

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210860

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	G	5: 9,410,700	Y207C	probably damaging	Het
Abca13	A	G	11: 9,291,577	I1147V	probably benign	Het
Adcy10	A	G	1: 165,543,110	T653A	probably benign	Het
App	A	G	16: 84,962,741	I656T	probably damaging	Het
Arnt	T	A	3: 95,490,568	I574N	possibly damaging	Het
Cdc42	T	C	4: 137,329,080	T75A	probably benign	Het
Cdh23	C	A	10: 60,413,663	K822N	possibly damaging	Het
Chrnb3	T	A	8: 27,394,566	L444I	unknown	Het
Ctnnbl1	G	T	2: 157,836,663	K395N	possibly damaging	Het
Dmxl1	T	A	18: 49,893,249	I1808K	probably benign	Het
Dnajb8	C	A	6: 88,222,902	P140Q	probably damaging	Het
Dock5	G	A	14: 67,759,114	R1727W	probably damaging	Het
Dscam	G	A	16: 96,685,229	T1082I	possibly damaging	Het
Eaf1	T	C	14: 31,497,809		probably benign	Het
Enpp3	T	C	10: 24,778,791	D663G	probably damaging	Het
Epha5	A	G	5: 84,117,582	V451A	probably benign	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Esco2	A	G	14: 65,821,639	W530R	probably damaging	Het
Fam160a2	A	G	7: 105,389,663	V123A	possibly damaging	Het
Fhod3	T	C	18: 25,115,865	I1367T	probably damaging	Het
Fryl	T	C	5: 73,191,519		probably benign	Het
Gm15448	T	C	7: 3,822,227	D472G	unknown	Het
Gm42669	A	G	5: 107,508,504	T295A	possibly damaging	Het
Harbi1	A	G	2: 91,712,695	N167S	probably damaging	Het
Hfm1	A	C	5: 106,874,900	N945K	probably damaging	Het
Htr1f	G	T	16: 64,926,494	T145K	probably benign	Het
Igf2bp2	A	C	16: 22,068,151	S453A	possibly damaging	Het
Ipo4	A	T	14: 55,634,342	W116R	probably damaging	Het
Jak1	T	C	4: 101,157,843	H917R	probably benign	Het
Klrb1b	A	T	6: 128,815,282	C189*	probably null	Het
Lrrn2	A	G	1: 132,937,320	Y41C	probably damaging	Het
Lrrn2	T	C	1: 132,937,499	S101P	probably damaging	Het
Mcmdc2	C	T	1: 9,915,610	T127I	probably damaging	Het
Mtch1	C	A	17: 29,347,652	A46S	unknown	Het
Ndufb5	C	A	3: 32,741,757	Q33K	probably null	Het
Nufip2	T	C	11: 77,692,649	V463A	probably damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1062	A	T	2: 86,423,079	V199E	probably damaging	Het
Olfr212	G	A	6: 116,515,821	V15I	probably benign	Het
Olfr457	T	A	6: 42,471,603	I192F	possibly damaging	Het
Olfr486	A	G	7: 108,172,645	I33T	probably benign	Het
Ppip5k1	A	C	2: 121,334,451	S972A	probably benign	Het
Prl8a2	A	T	13: 27,350,999	M86L	probably benign	Het
Prorsd1	T	C	11: 29,513,271	I164V	probably benign	Het
Ptgs1	A	G	2: 36,240,712	T208A	probably damaging	Het
Ptpn3	A	T	4: 57,254,915		probably null	Het
Reln	T	C	5: 21,915,153	R2834G	probably damaging	Het
Shc4	G	T	2: 125,655,669	Y373*	probably null	Het
Skor1	A	T	9: 63,142,242		probably null	Het
Slc9a4	T	C	1: 40,619,089	S591P	probably damaging	Het
Stat2	A	G	10: 128,282,765	E389G	possibly damaging	Het
Trav14n-3	C	A	14: 53,370,547	D111E	probably damaging	Het
Unc5c	A	G	3: 141,827,609	S873G	probably benign	Het
Vmn1r210	T	C	13: 22,827,919	I66V	probably benign	Het
Vmn2r117	T	A	17: 23,477,615	I273F	probably damaging	Het
Vmn2r95	T	A	17: 18,451,927	M714K	possibly damaging	Het
Wrb	A	G	16: 96,154,183	T147A	probably benign	Het
Zfp235	A	G	7: 24,140,494	T113A	probably benign	Het
Zranb1	T	G	7: 132,983,911	L696R	probably damaging	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTGACTGCCATGGGAATCTAAC -3'
(R):5'- TGCTCAGGAGGAATGGAATTTG -3'

Sequencing Primer
(F):5'- GCCATGGGAATCTAACATTTATTTG -3'
(R):5'- TCTCCCTAAGGAAAATTATGAGACAC -3'

Posted On

2022-03-25