Incidental Mutation 'R9245:Baz2b'
ID 701189
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R9245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 59899363-60209839 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59912987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1547 (M1547V)
Ref Sequence ENSEMBL: ENSMUSP00000088443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect probably benign
Transcript: ENSMUST00000090925
AA Change: M1547V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: M1547V

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
AA Change: M1547V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: M1547V

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,720 D3152G probably benign Het
Abhd15 C A 11: 77,515,486 H96Q possibly damaging Het
Ankhd1 A G 18: 36,655,600 Q411R Het
Ankrd34c A T 9: 89,728,887 V467E probably damaging Het
Apobr A T 7: 126,587,335 R673* probably null Het
Arhgap18 T C 10: 26,846,111 V98A possibly damaging Het
Arhgap30 G T 1: 171,408,389 W777L possibly damaging Het
Atp8a1 A G 5: 67,622,634 Y1154H unknown Het
B3gntl1 A G 11: 121,623,944 F299S possibly damaging Het
Baz2a C T 10: 128,121,943 T1055I probably benign Het
BC048403 A T 10: 121,750,368 H196L probably damaging Het
Bsn T C 9: 108,116,093 D820G probably damaging Het
Ccdc57 A G 11: 120,921,752 Y59H probably damaging Het
Crim1 T A 17: 78,344,442 C532S probably damaging Het
Csmd2 A C 4: 128,306,375 D451A Het
Cyp2d22 A T 15: 82,372,547 I342K probably damaging Het
Des A T 1: 75,366,762 T430S probably benign Het
Dnah17 C T 11: 118,125,677 V283I probably benign Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dst A G 1: 34,189,862 S2179G probably benign Het
Esrp2 T A 8: 106,132,143 T621S possibly damaging Het
Ext2 C T 2: 93,704,491 V643I probably benign Het
Fastk G A 5: 24,444,174 P72S probably benign Het
Fbxo28 A G 1: 182,318,001 I174T possibly damaging Het
Fstl3 C T 10: 79,778,577 L38F probably damaging Het
Gatsl3 T A 11: 4,220,485 N160K probably damaging Het
Gm960 T G 19: 4,696,040 K199Q possibly damaging Het
Golgb1 C T 16: 36,918,819 Q2548* probably null Het
Gstm3 T C 3: 107,967,640 T99A probably benign Het
Hadh T C 3: 131,240,987 N220S probably damaging Het
Hist1h2bn A G 13: 21,754,199 D26G unknown Het
Hnrnpab T C 11: 51,606,413 T51A probably benign Het
Ikbkap C A 4: 56,771,003 R980L probably benign Het
Immt G T 6: 71,846,366 W67L probably benign Het
Ints8 T A 4: 11,213,811 probably null Het
Ipo7 T C 7: 110,044,619 V407A probably damaging Het
Kif20b T C 19: 34,938,325 S501P probably benign Het
Krt39 T G 11: 99,516,624 Q348P probably damaging Het
Lrp1b T A 2: 40,598,444 N4543I Het
Macrod2 T C 2: 141,810,614 V199A probably benign Het
Mast2 A G 4: 116,310,504 V1052A probably damaging Het
Mfap4 T C 11: 61,487,181 F149S probably damaging Het
Moap1 A G 12: 102,742,267 V341A unknown Het
Mprip G T 11: 59,737,577 E283D possibly damaging Het
Mrgpra2a A G 7: 47,427,256 F85L possibly damaging Het
Mx1 T A 16: 97,451,553 probably null Het
Ndc80 A T 17: 71,500,299 M554K probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr172 T A 16: 58,760,763 K138* probably null Het
Olfr592 A T 7: 103,186,987 I129F probably damaging Het
Olfr768 T A 10: 129,093,603 I124F probably damaging Het
Pck1 C T 2: 173,154,776 T161I probably damaging Het
Pclo T A 5: 14,676,945 M1939K unknown Het
Pcm1 T A 8: 41,279,840 N711K probably damaging Het
Pkd2l1 A G 19: 44,155,455 V393A probably benign Het
Pla2g15 G T 8: 106,162,907 A229S possibly damaging Het
Plekhg1 G A 10: 3,957,141 R741Q Het
Plod1 A G 4: 147,926,169 L275P possibly damaging Het
Plvap G T 8: 71,511,679 T13K possibly damaging Het
Plxna1 A T 6: 89,337,338 I707N probably damaging Het
Pnmal2 A G 7: 16,946,918 E609G probably benign Het
Ptger4 C T 15: 5,243,712 probably benign Het
Qars G T 9: 108,508,933 E108* probably null Het
Rfpl4 C A 7: 5,110,841 D114Y probably damaging Het
Rint1 A G 5: 23,805,413 T207A probably benign Het
Rxfp1 A G 3: 79,644,954 I680T probably benign Het
Skint2 A T 4: 112,645,419 K275N probably benign Het
Slc29a3 A G 10: 60,723,976 V133A possibly damaging Het
Slc9a2 A G 1: 40,766,300 K680E probably benign Het
Smc1b A T 15: 85,120,645 F409L probably benign Het
Sos2 A T 12: 69,648,465 M166K probably damaging Het
Tead1 A G 7: 112,759,516 I12V probably benign Het
Tead3 C A 17: 28,332,735 K461N probably benign Het
Tex12 C A 9: 50,557,472 A83S probably damaging Het
Ttc28 A G 5: 111,177,659 T319A unknown Het
Ttn T C 2: 76,898,249 I5496V unknown Het
Tubb4a T A 17: 57,080,959 I356F possibly damaging Het
Txk A T 5: 72,734,267 W119R probably damaging Het
Txnl4a A T 18: 80,218,722 I58F probably benign Het
Uba6 A T 5: 86,170,559 Y44N probably damaging Het
Usp40 T C 1: 87,950,287 T1093A probably benign Het
Vmn1r194 T C 13: 22,244,561 I116T probably benign Het
Vmn2r14 A G 5: 109,220,310 M272T possibly damaging Het
Vmn2r85 C A 10: 130,419,164 M550I possibly damaging Het
Vmn2r85 C A 10: 130,425,665 V268F probably damaging Het
Vwa5b2 T A 16: 20,598,140 V529E probably damaging Het
Zfp141 A T 7: 42,475,397 Y550* probably null Het
Zik1 G A 7: 10,490,229 L314F probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
R8893:Baz2b UTSW 2 59924805 missense probably damaging 0.96
R8947:Baz2b UTSW 2 59948239 missense probably benign 0.06
R8998:Baz2b UTSW 2 59969264 missense probably benign 0.02
R9241:Baz2b UTSW 2 59913649 missense probably benign 0.01
R9577:Baz2b UTSW 2 59978687 missense probably benign 0.06
R9581:Baz2b UTSW 2 59968956 missense probably benign
R9601:Baz2b UTSW 2 59901503 missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59901480 missense probably benign 0.09
R9639:Baz2b UTSW 2 59901484 missense probably benign 0.01
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTACTTCAACAGCCACTGG -3'
(R):5'- TCCTCCAACTCTTTAGATGAATTGG -3'

Sequencing Primer
(F):5'- CGCTGGAGGGTCTTTCAGC -3'
(R):5'- TCTTTCCATCATGTGGGC -3'
Posted On 2022-03-25