Incidental Mutation 'R9245:Csmd2'
ID 701201
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R9245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128306375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 451 (D451A)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,720 D3152G probably benign Het
Abhd15 C A 11: 77,515,486 H96Q possibly damaging Het
Ankhd1 A G 18: 36,655,600 Q411R Het
Ankrd34c A T 9: 89,728,887 V467E probably damaging Het
Apobr A T 7: 126,587,335 R673* probably null Het
Arhgap18 T C 10: 26,846,111 V98A possibly damaging Het
Arhgap30 G T 1: 171,408,389 W777L possibly damaging Het
Atp8a1 A G 5: 67,622,634 Y1154H unknown Het
B3gntl1 A G 11: 121,623,944 F299S possibly damaging Het
Baz2a C T 10: 128,121,943 T1055I probably benign Het
Baz2b T C 2: 59,912,987 M1547V probably benign Het
BC048403 A T 10: 121,750,368 H196L probably damaging Het
Bsn T C 9: 108,116,093 D820G probably damaging Het
Ccdc57 A G 11: 120,921,752 Y59H probably damaging Het
Crim1 T A 17: 78,344,442 C532S probably damaging Het
Cyp2d22 A T 15: 82,372,547 I342K probably damaging Het
Des A T 1: 75,366,762 T430S probably benign Het
Dnah17 C T 11: 118,125,677 V283I probably benign Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dst A G 1: 34,189,862 S2179G probably benign Het
Esrp2 T A 8: 106,132,143 T621S possibly damaging Het
Ext2 C T 2: 93,704,491 V643I probably benign Het
Fastk G A 5: 24,444,174 P72S probably benign Het
Fbxo28 A G 1: 182,318,001 I174T possibly damaging Het
Fstl3 C T 10: 79,778,577 L38F probably damaging Het
Gatsl3 T A 11: 4,220,485 N160K probably damaging Het
Gm960 T G 19: 4,696,040 K199Q possibly damaging Het
Golgb1 C T 16: 36,918,819 Q2548* probably null Het
Gstm3 T C 3: 107,967,640 T99A probably benign Het
Hadh T C 3: 131,240,987 N220S probably damaging Het
Hist1h2bn A G 13: 21,754,199 D26G unknown Het
Hnrnpab T C 11: 51,606,413 T51A probably benign Het
Ikbkap C A 4: 56,771,003 R980L probably benign Het
Immt G T 6: 71,846,366 W67L probably benign Het
Ints8 T A 4: 11,213,811 probably null Het
Ipo7 T C 7: 110,044,619 V407A probably damaging Het
Kif20b T C 19: 34,938,325 S501P probably benign Het
Krt39 T G 11: 99,516,624 Q348P probably damaging Het
Lrp1b T A 2: 40,598,444 N4543I Het
Macrod2 T C 2: 141,810,614 V199A probably benign Het
Mast2 A G 4: 116,310,504 V1052A probably damaging Het
Mfap4 T C 11: 61,487,181 F149S probably damaging Het
Moap1 A G 12: 102,742,267 V341A unknown Het
Mprip G T 11: 59,737,577 E283D possibly damaging Het
Mrgpra2a A G 7: 47,427,256 F85L possibly damaging Het
Mx1 T A 16: 97,451,553 probably null Het
Ndc80 A T 17: 71,500,299 M554K probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr172 T A 16: 58,760,763 K138* probably null Het
Olfr592 A T 7: 103,186,987 I129F probably damaging Het
Olfr768 T A 10: 129,093,603 I124F probably damaging Het
Pck1 C T 2: 173,154,776 T161I probably damaging Het
Pclo T A 5: 14,676,945 M1939K unknown Het
Pcm1 T A 8: 41,279,840 N711K probably damaging Het
Pkd2l1 A G 19: 44,155,455 V393A probably benign Het
Pla2g15 G T 8: 106,162,907 A229S possibly damaging Het
Plekhg1 G A 10: 3,957,141 R741Q Het
Plod1 A G 4: 147,926,169 L275P possibly damaging Het
Plvap G T 8: 71,511,679 T13K possibly damaging Het
Plxna1 A T 6: 89,337,338 I707N probably damaging Het
Pnmal2 A G 7: 16,946,918 E609G probably benign Het
Ptger4 C T 15: 5,243,712 probably benign Het
Qars G T 9: 108,508,933 E108* probably null Het
Rfpl4 C A 7: 5,110,841 D114Y probably damaging Het
Rint1 A G 5: 23,805,413 T207A probably benign Het
Rxfp1 A G 3: 79,644,954 I680T probably benign Het
Skint2 A T 4: 112,645,419 K275N probably benign Het
Slc29a3 A G 10: 60,723,976 V133A possibly damaging Het
Slc9a2 A G 1: 40,766,300 K680E probably benign Het
Smc1b A T 15: 85,120,645 F409L probably benign Het
Sos2 A T 12: 69,648,465 M166K probably damaging Het
Tead1 A G 7: 112,759,516 I12V probably benign Het
Tead3 C A 17: 28,332,735 K461N probably benign Het
Tex12 C A 9: 50,557,472 A83S probably damaging Het
Ttc28 A G 5: 111,177,659 T319A unknown Het
Ttn T C 2: 76,898,249 I5496V unknown Het
Tubb4a T A 17: 57,080,959 I356F possibly damaging Het
Txk A T 5: 72,734,267 W119R probably damaging Het
Txnl4a A T 18: 80,218,722 I58F probably benign Het
Uba6 A T 5: 86,170,559 Y44N probably damaging Het
Usp40 T C 1: 87,950,287 T1093A probably benign Het
Vmn1r194 T C 13: 22,244,561 I116T probably benign Het
Vmn2r14 A G 5: 109,220,310 M272T possibly damaging Het
Vmn2r85 C A 10: 130,419,164 M550I possibly damaging Het
Vmn2r85 C A 10: 130,425,665 V268F probably damaging Het
Vwa5b2 T A 16: 20,598,140 V529E probably damaging Het
Zfp141 A T 7: 42,475,397 Y550* probably null Het
Zik1 G A 7: 10,490,229 L314F probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8928:Csmd2 UTSW 4 128475789 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
R9132:Csmd2 UTSW 4 128549214 missense
R9249:Csmd2 UTSW 4 128419530 nonsense probably null
R9254:Csmd2 UTSW 4 128197319 missense
R9265:Csmd2 UTSW 4 128400370 missense
R9407:Csmd2 UTSW 4 128548820 missense
R9432:Csmd2 UTSW 4 128277211 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CTTGAGGAGAGTGTTGAGCC -3'
(R):5'- TCCTCATAGGCAATCGATCGTTC -3'

Sequencing Primer
(F):5'- AGGCACTGTGACTTGGCTC -3'
(R):5'- TAGGCAATCGATCGTTCCCTAAC -3'
Posted On 2022-03-25