Incidental Mutation 'R9245:Rint1'
ID 701204
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene Name RAD50 interactor 1
Synonyms 1500019C06Rik, 2810450M21Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 23992709-24025367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24010411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 207 (T207A)
Ref Sequence ENSEMBL: ENSMUSP00000030852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
AlphaFold Q8BZ36
Predicted Effect probably benign
Transcript: ENSMUST00000030852
AA Change: T207A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: T207A

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115113
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C A 11: 77,406,312 (GRCm39) H96Q possibly damaging Het
Ankhd1 A G 18: 36,788,653 (GRCm39) Q411R Het
Ankrd34c A T 9: 89,610,940 (GRCm39) V467E probably damaging Het
Apobr A T 7: 126,186,507 (GRCm39) R673* probably null Het
Arhgap18 T C 10: 26,722,107 (GRCm39) V98A possibly damaging Het
Arhgap30 G T 1: 171,235,957 (GRCm39) W777L possibly damaging Het
Atp8a1 A G 5: 67,779,977 (GRCm39) Y1154H unknown Het
B3gntl1 A G 11: 121,514,770 (GRCm39) F299S possibly damaging Het
Baz2a C T 10: 127,957,812 (GRCm39) T1055I probably benign Het
Baz2b T C 2: 59,743,331 (GRCm39) M1547V probably benign Het
Bsn T C 9: 107,993,292 (GRCm39) D820G probably damaging Het
Castor1 T A 11: 4,170,485 (GRCm39) N160K probably damaging Het
Ccdc57 A G 11: 120,812,578 (GRCm39) Y59H probably damaging Het
Crim1 T A 17: 78,651,871 (GRCm39) C532S probably damaging Het
Csmd2 A C 4: 128,200,168 (GRCm39) D451A Het
Cyp2d22 A T 15: 82,256,748 (GRCm39) I342K probably damaging Het
Des A T 1: 75,343,406 (GRCm39) T430S probably benign Het
Dnah17 C T 11: 118,016,503 (GRCm39) V283I probably benign Het
Dnah9 C T 11: 65,786,731 (GRCm39) G3634E probably benign Het
Dst A G 1: 34,228,943 (GRCm39) S2179G probably benign Het
Elp1 C A 4: 56,771,003 (GRCm39) R980L probably benign Het
Esrp2 T A 8: 106,858,775 (GRCm39) T621S possibly damaging Het
Ext2 C T 2: 93,534,836 (GRCm39) V643I probably benign Het
Fastk G A 5: 24,649,172 (GRCm39) P72S probably benign Het
Fbxo28 A G 1: 182,145,566 (GRCm39) I174T possibly damaging Het
Fstl3 C T 10: 79,614,411 (GRCm39) L38F probably damaging Het
Golgb1 C T 16: 36,739,181 (GRCm39) Q2548* probably null Het
Gstm3 T C 3: 107,874,956 (GRCm39) T99A probably benign Het
H2bc15 A G 13: 21,938,369 (GRCm39) D26G unknown Het
Hadh T C 3: 131,034,636 (GRCm39) N220S probably damaging Het
Hnrnpab T C 11: 51,497,240 (GRCm39) T51A probably benign Het
Immt G T 6: 71,823,350 (GRCm39) W67L probably benign Het
Ints8 T A 4: 11,213,811 (GRCm39) probably null Het
Ipo7 T C 7: 109,643,826 (GRCm39) V407A probably damaging Het
Kics2 A T 10: 121,586,273 (GRCm39) H196L probably damaging Het
Kif20b T C 19: 34,915,725 (GRCm39) S501P probably benign Het
Krt39 T G 11: 99,407,450 (GRCm39) Q348P probably damaging Het
Lrp1b T A 2: 40,488,456 (GRCm39) N4543I Het
Macrod2 T C 2: 141,652,534 (GRCm39) V199A probably benign Het
Mast2 A G 4: 116,167,701 (GRCm39) V1052A probably damaging Het
Mfap4 T C 11: 61,378,007 (GRCm39) F149S probably damaging Het
Moap1 A G 12: 102,708,526 (GRCm39) V341A unknown Het
Mprip G T 11: 59,628,403 (GRCm39) E283D possibly damaging Het
Mrgpra2a A G 7: 47,077,004 (GRCm39) F85L possibly damaging Het
Mx1 T A 16: 97,252,753 (GRCm39) probably null Het
Ndc80 A T 17: 71,807,294 (GRCm39) M554K probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Or52j3 A T 7: 102,836,194 (GRCm39) I129F probably damaging Het
Or5k1b T A 16: 58,581,126 (GRCm39) K138* probably null Het
Or6c38 T A 10: 128,929,472 (GRCm39) I124F probably damaging Het
Pck1 C T 2: 172,996,569 (GRCm39) T161I probably damaging Het
Pclo T A 5: 14,726,959 (GRCm39) M1939K unknown Het
Pcm1 T A 8: 41,732,877 (GRCm39) N711K probably damaging Het
Pkd2l1 A G 19: 44,143,894 (GRCm39) V393A probably benign Het
Pla2g15 G T 8: 106,889,539 (GRCm39) A229S possibly damaging Het
Plekhg1 G A 10: 3,907,141 (GRCm39) R741Q Het
Plod1 A G 4: 148,010,626 (GRCm39) L275P possibly damaging Het
Plvap G T 8: 71,964,323 (GRCm39) T13K possibly damaging Het
Plxna1 A T 6: 89,314,320 (GRCm39) I707N probably damaging Het
Pnma8b A G 7: 16,680,843 (GRCm39) E609G probably benign Het
Ptger4 C T 15: 5,273,193 (GRCm39) probably benign Het
Qars1 G T 9: 108,386,132 (GRCm39) E108* probably null Het
Rfpl4 C A 7: 5,113,840 (GRCm39) D114Y probably damaging Het
Rxfp1 A G 3: 79,552,261 (GRCm39) I680T probably benign Het
Skint2 A T 4: 112,502,616 (GRCm39) K275N probably benign Het
Slc29a3 A G 10: 60,559,755 (GRCm39) V133A possibly damaging Het
Slc9a2 A G 1: 40,805,460 (GRCm39) K680E probably benign Het
Smc1b A T 15: 85,004,846 (GRCm39) F409L probably benign Het
Sos2 A T 12: 69,695,239 (GRCm39) M166K probably damaging Het
Spata31h1 T C 10: 82,123,554 (GRCm39) D3152G probably benign Het
Tead1 A G 7: 112,358,723 (GRCm39) I12V probably benign Het
Tead3 C A 17: 28,551,709 (GRCm39) K461N probably benign Het
Tex12 C A 9: 50,468,772 (GRCm39) A83S probably damaging Het
Top6bl T G 19: 4,746,068 (GRCm39) K199Q possibly damaging Het
Ttc28 A G 5: 111,325,525 (GRCm39) T319A unknown Het
Ttn T C 2: 76,728,593 (GRCm39) I5496V unknown Het
Tubb4a T A 17: 57,387,959 (GRCm39) I356F possibly damaging Het
Txk A T 5: 72,891,610 (GRCm39) W119R probably damaging Het
Txnl4a A T 18: 80,261,937 (GRCm39) I58F probably benign Het
Uba6 A T 5: 86,318,418 (GRCm39) Y44N probably damaging Het
Usp40 T C 1: 87,878,009 (GRCm39) T1093A probably benign Het
Vmn1r194 T C 13: 22,428,731 (GRCm39) I116T probably benign Het
Vmn2r14 A G 5: 109,368,176 (GRCm39) M272T possibly damaging Het
Vmn2r85 C A 10: 130,255,033 (GRCm39) M550I possibly damaging Het
Vmn2r85 C A 10: 130,261,534 (GRCm39) V268F probably damaging Het
Vwa5b2 T A 16: 20,416,890 (GRCm39) V529E probably damaging Het
Zfp141 A T 7: 42,124,821 (GRCm39) Y550* probably null Het
Zik1 G A 7: 10,224,156 (GRCm39) L314F probably damaging Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23,999,429 (GRCm39) missense probably benign 0.00
IGL00596:Rint1 APN 5 24,016,863 (GRCm39) missense probably damaging 0.99
IGL01685:Rint1 APN 5 23,992,832 (GRCm39) unclassified probably benign
IGL02428:Rint1 APN 5 23,999,450 (GRCm39) nonsense probably null
IGL03007:Rint1 APN 5 24,020,699 (GRCm39) missense probably benign 0.00
IGL03280:Rint1 APN 5 24,022,076 (GRCm39) missense probably damaging 1.00
breakage UTSW 5 24,005,720 (GRCm39) missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 24,024,478 (GRCm39) missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23,992,826 (GRCm39) unclassified probably benign
R0243:Rint1 UTSW 5 24,021,930 (GRCm39) splice site probably benign
R1102:Rint1 UTSW 5 24,010,565 (GRCm39) splice site probably benign
R1552:Rint1 UTSW 5 24,005,656 (GRCm39) missense probably benign 0.00
R1729:Rint1 UTSW 5 24,014,841 (GRCm39) missense probably benign 0.00
R1784:Rint1 UTSW 5 24,014,841 (GRCm39) missense probably benign 0.00
R2070:Rint1 UTSW 5 24,015,927 (GRCm39) missense possibly damaging 0.94
R2920:Rint1 UTSW 5 24,010,400 (GRCm39) missense probably benign 0.00
R3114:Rint1 UTSW 5 24,024,418 (GRCm39) missense probably benign 0.27
R4398:Rint1 UTSW 5 23,999,445 (GRCm39) missense possibly damaging 0.55
R4756:Rint1 UTSW 5 24,014,791 (GRCm39) missense probably damaging 1.00
R5246:Rint1 UTSW 5 24,005,809 (GRCm39) missense probably damaging 0.99
R5452:Rint1 UTSW 5 23,999,363 (GRCm39) missense probably benign 0.01
R5566:Rint1 UTSW 5 24,015,951 (GRCm39) missense probably damaging 1.00
R5709:Rint1 UTSW 5 24,020,831 (GRCm39) missense probably damaging 0.98
R6524:Rint1 UTSW 5 24,020,737 (GRCm39) missense probably benign 0.00
R7346:Rint1 UTSW 5 24,020,651 (GRCm39) missense possibly damaging 0.82
R7549:Rint1 UTSW 5 24,020,702 (GRCm39) missense probably benign
R7634:Rint1 UTSW 5 24,010,477 (GRCm39) missense probably benign 0.00
R7647:Rint1 UTSW 5 24,005,800 (GRCm39) missense probably damaging 1.00
R7885:Rint1 UTSW 5 24,010,642 (GRCm39) missense probably benign
R7895:Rint1 UTSW 5 24,005,720 (GRCm39) missense probably damaging 0.99
R8347:Rint1 UTSW 5 24,016,770 (GRCm39) missense probably damaging 1.00
R8791:Rint1 UTSW 5 24,005,594 (GRCm39) missense probably damaging 0.99
R8900:Rint1 UTSW 5 24,016,882 (GRCm39) missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23,992,826 (GRCm39) unclassified probably benign
R8973:Rint1 UTSW 5 24,016,728 (GRCm39) missense probably benign 0.00
R9339:Rint1 UTSW 5 23,993,355 (GRCm39) makesense probably null
R9630:Rint1 UTSW 5 24,020,810 (GRCm39) missense possibly damaging 0.82
R9718:Rint1 UTSW 5 24,005,721 (GRCm39) missense possibly damaging 0.53
Z1088:Rint1 UTSW 5 24,010,312 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGATGGTTTAGTCAGCACAGTG -3'
(R):5'- AAGACTTCCTCAAAATCACTGTAACA -3'

Sequencing Primer
(F):5'- GACTCCAGGTGAATTACTGAGCTC -3'
(R):5'- TGTAACAGAAAAGAAACAATGCTTCC -3'
Posted On 2022-03-25