Incidental Mutation 'R9245:Bsn'
ID 701228
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R9245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107973221-108067583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107993292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 820 (D820G)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: D820G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: D820G

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C A 11: 77,406,312 (GRCm39) H96Q possibly damaging Het
Ankhd1 A G 18: 36,788,653 (GRCm39) Q411R Het
Ankrd34c A T 9: 89,610,940 (GRCm39) V467E probably damaging Het
Apobr A T 7: 126,186,507 (GRCm39) R673* probably null Het
Arhgap18 T C 10: 26,722,107 (GRCm39) V98A possibly damaging Het
Arhgap30 G T 1: 171,235,957 (GRCm39) W777L possibly damaging Het
Atp8a1 A G 5: 67,779,977 (GRCm39) Y1154H unknown Het
B3gntl1 A G 11: 121,514,770 (GRCm39) F299S possibly damaging Het
Baz2a C T 10: 127,957,812 (GRCm39) T1055I probably benign Het
Baz2b T C 2: 59,743,331 (GRCm39) M1547V probably benign Het
Castor1 T A 11: 4,170,485 (GRCm39) N160K probably damaging Het
Ccdc57 A G 11: 120,812,578 (GRCm39) Y59H probably damaging Het
Crim1 T A 17: 78,651,871 (GRCm39) C532S probably damaging Het
Csmd2 A C 4: 128,200,168 (GRCm39) D451A Het
Cyp2d22 A T 15: 82,256,748 (GRCm39) I342K probably damaging Het
Des A T 1: 75,343,406 (GRCm39) T430S probably benign Het
Dnah17 C T 11: 118,016,503 (GRCm39) V283I probably benign Het
Dnah9 C T 11: 65,786,731 (GRCm39) G3634E probably benign Het
Dst A G 1: 34,228,943 (GRCm39) S2179G probably benign Het
Elp1 C A 4: 56,771,003 (GRCm39) R980L probably benign Het
Esrp2 T A 8: 106,858,775 (GRCm39) T621S possibly damaging Het
Ext2 C T 2: 93,534,836 (GRCm39) V643I probably benign Het
Fastk G A 5: 24,649,172 (GRCm39) P72S probably benign Het
Fbxo28 A G 1: 182,145,566 (GRCm39) I174T possibly damaging Het
Fstl3 C T 10: 79,614,411 (GRCm39) L38F probably damaging Het
Golgb1 C T 16: 36,739,181 (GRCm39) Q2548* probably null Het
Gstm3 T C 3: 107,874,956 (GRCm39) T99A probably benign Het
H2bc15 A G 13: 21,938,369 (GRCm39) D26G unknown Het
Hadh T C 3: 131,034,636 (GRCm39) N220S probably damaging Het
Hnrnpab T C 11: 51,497,240 (GRCm39) T51A probably benign Het
Immt G T 6: 71,823,350 (GRCm39) W67L probably benign Het
Ints8 T A 4: 11,213,811 (GRCm39) probably null Het
Ipo7 T C 7: 109,643,826 (GRCm39) V407A probably damaging Het
Kics2 A T 10: 121,586,273 (GRCm39) H196L probably damaging Het
Kif20b T C 19: 34,915,725 (GRCm39) S501P probably benign Het
Krt39 T G 11: 99,407,450 (GRCm39) Q348P probably damaging Het
Lrp1b T A 2: 40,488,456 (GRCm39) N4543I Het
Macrod2 T C 2: 141,652,534 (GRCm39) V199A probably benign Het
Mast2 A G 4: 116,167,701 (GRCm39) V1052A probably damaging Het
Mfap4 T C 11: 61,378,007 (GRCm39) F149S probably damaging Het
Moap1 A G 12: 102,708,526 (GRCm39) V341A unknown Het
Mprip G T 11: 59,628,403 (GRCm39) E283D possibly damaging Het
Mrgpra2a A G 7: 47,077,004 (GRCm39) F85L possibly damaging Het
Mx1 T A 16: 97,252,753 (GRCm39) probably null Het
Ndc80 A T 17: 71,807,294 (GRCm39) M554K probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Or52j3 A T 7: 102,836,194 (GRCm39) I129F probably damaging Het
Or5k1b T A 16: 58,581,126 (GRCm39) K138* probably null Het
Or6c38 T A 10: 128,929,472 (GRCm39) I124F probably damaging Het
Pck1 C T 2: 172,996,569 (GRCm39) T161I probably damaging Het
Pclo T A 5: 14,726,959 (GRCm39) M1939K unknown Het
Pcm1 T A 8: 41,732,877 (GRCm39) N711K probably damaging Het
Pkd2l1 A G 19: 44,143,894 (GRCm39) V393A probably benign Het
Pla2g15 G T 8: 106,889,539 (GRCm39) A229S possibly damaging Het
Plekhg1 G A 10: 3,907,141 (GRCm39) R741Q Het
Plod1 A G 4: 148,010,626 (GRCm39) L275P possibly damaging Het
Plvap G T 8: 71,964,323 (GRCm39) T13K possibly damaging Het
Plxna1 A T 6: 89,314,320 (GRCm39) I707N probably damaging Het
Pnma8b A G 7: 16,680,843 (GRCm39) E609G probably benign Het
Ptger4 C T 15: 5,273,193 (GRCm39) probably benign Het
Qars1 G T 9: 108,386,132 (GRCm39) E108* probably null Het
Rfpl4 C A 7: 5,113,840 (GRCm39) D114Y probably damaging Het
Rint1 A G 5: 24,010,411 (GRCm39) T207A probably benign Het
Rxfp1 A G 3: 79,552,261 (GRCm39) I680T probably benign Het
Skint2 A T 4: 112,502,616 (GRCm39) K275N probably benign Het
Slc29a3 A G 10: 60,559,755 (GRCm39) V133A possibly damaging Het
Slc9a2 A G 1: 40,805,460 (GRCm39) K680E probably benign Het
Smc1b A T 15: 85,004,846 (GRCm39) F409L probably benign Het
Sos2 A T 12: 69,695,239 (GRCm39) M166K probably damaging Het
Spata31h1 T C 10: 82,123,554 (GRCm39) D3152G probably benign Het
Tead1 A G 7: 112,358,723 (GRCm39) I12V probably benign Het
Tead3 C A 17: 28,551,709 (GRCm39) K461N probably benign Het
Tex12 C A 9: 50,468,772 (GRCm39) A83S probably damaging Het
Top6bl T G 19: 4,746,068 (GRCm39) K199Q possibly damaging Het
Ttc28 A G 5: 111,325,525 (GRCm39) T319A unknown Het
Ttn T C 2: 76,728,593 (GRCm39) I5496V unknown Het
Tubb4a T A 17: 57,387,959 (GRCm39) I356F possibly damaging Het
Txk A T 5: 72,891,610 (GRCm39) W119R probably damaging Het
Txnl4a A T 18: 80,261,937 (GRCm39) I58F probably benign Het
Uba6 A T 5: 86,318,418 (GRCm39) Y44N probably damaging Het
Usp40 T C 1: 87,878,009 (GRCm39) T1093A probably benign Het
Vmn1r194 T C 13: 22,428,731 (GRCm39) I116T probably benign Het
Vmn2r14 A G 5: 109,368,176 (GRCm39) M272T possibly damaging Het
Vmn2r85 C A 10: 130,255,033 (GRCm39) M550I possibly damaging Het
Vmn2r85 C A 10: 130,261,534 (GRCm39) V268F probably damaging Het
Vwa5b2 T A 16: 20,416,890 (GRCm39) V529E probably damaging Het
Zfp141 A T 7: 42,124,821 (GRCm39) Y550* probably null Het
Zik1 G A 7: 10,224,156 (GRCm39) L314F probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 107,992,309 (GRCm39) missense probably benign 0.01
IGL00330:Bsn APN 9 107,992,539 (GRCm39) missense probably damaging 1.00
IGL00863:Bsn APN 9 107,992,521 (GRCm39) missense probably damaging 1.00
IGL01123:Bsn APN 9 107,993,185 (GRCm39) missense probably damaging 1.00
IGL01330:Bsn APN 9 107,988,112 (GRCm39) unclassified probably benign
IGL01336:Bsn APN 9 107,988,984 (GRCm39) missense probably damaging 0.99
IGL01399:Bsn APN 9 107,984,386 (GRCm39) missense unknown
IGL01683:Bsn APN 9 107,992,095 (GRCm39) missense possibly damaging 0.71
IGL02022:Bsn APN 9 107,987,617 (GRCm39) unclassified probably benign
IGL02396:Bsn APN 9 107,993,245 (GRCm39) missense possibly damaging 0.90
IGL02538:Bsn APN 9 107,982,435 (GRCm39) missense unknown
IGL02565:Bsn APN 9 107,990,487 (GRCm39) missense probably damaging 0.99
IGL02661:Bsn APN 9 107,984,135 (GRCm39) nonsense probably null
IGL02739:Bsn APN 9 107,989,745 (GRCm39) missense probably benign 0.14
IGL02951:Bsn APN 9 107,992,812 (GRCm39) missense probably damaging 1.00
IGL02987:Bsn APN 9 108,003,503 (GRCm39) missense probably benign 0.03
IGL03033:Bsn APN 9 107,993,192 (GRCm39) missense probably damaging 1.00
IGL03069:Bsn APN 9 107,991,462 (GRCm39) missense probably damaging 1.00
IGL03076:Bsn APN 9 107,982,581 (GRCm39) missense unknown
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0167:Bsn UTSW 9 108,003,185 (GRCm39) missense probably benign 0.01
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0359:Bsn UTSW 9 107,989,045 (GRCm39) missense possibly damaging 0.81
R0514:Bsn UTSW 9 108,002,981 (GRCm39) missense probably benign 0.07
R0593:Bsn UTSW 9 107,987,505 (GRCm39) missense unknown
R0617:Bsn UTSW 9 107,984,439 (GRCm39) missense unknown
R0636:Bsn UTSW 9 107,985,033 (GRCm39) missense unknown
R0652:Bsn UTSW 9 107,982,941 (GRCm39) missense unknown
R0718:Bsn UTSW 9 107,988,559 (GRCm39) unclassified probably benign
R0730:Bsn UTSW 9 107,984,011 (GRCm39) missense unknown
R0905:Bsn UTSW 9 107,982,834 (GRCm39) missense unknown
R0963:Bsn UTSW 9 107,989,006 (GRCm39) missense possibly damaging 0.81
R0992:Bsn UTSW 9 107,991,553 (GRCm39) nonsense probably null
R1101:Bsn UTSW 9 107,993,610 (GRCm39) missense probably damaging 1.00
R1393:Bsn UTSW 9 107,987,716 (GRCm39) unclassified probably benign
R1490:Bsn UTSW 9 107,991,193 (GRCm39) missense probably benign 0.03
R1566:Bsn UTSW 9 108,003,184 (GRCm39) missense probably benign 0.35
R1582:Bsn UTSW 9 107,982,291 (GRCm39) missense unknown
R1738:Bsn UTSW 9 107,984,133 (GRCm39) missense unknown
R1867:Bsn UTSW 9 107,983,918 (GRCm39) missense unknown
R1918:Bsn UTSW 9 107,984,772 (GRCm39) missense unknown
R1933:Bsn UTSW 9 107,993,643 (GRCm39) missense possibly damaging 0.91
R1946:Bsn UTSW 9 107,991,850 (GRCm39) missense probably damaging 0.99
R1978:Bsn UTSW 9 107,991,748 (GRCm39) missense probably benign 0.35
R2068:Bsn UTSW 9 108,003,749 (GRCm39) missense possibly damaging 0.95
R2068:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R2113:Bsn UTSW 9 107,992,085 (GRCm39) missense probably benign 0.14
R2136:Bsn UTSW 9 107,990,430 (GRCm39) missense probably damaging 1.00
R2172:Bsn UTSW 9 107,987,191 (GRCm39) intron probably benign
R2266:Bsn UTSW 9 107,992,323 (GRCm39) missense probably damaging 1.00
R2293:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2294:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2368:Bsn UTSW 9 107,988,229 (GRCm39) nonsense probably null
R2442:Bsn UTSW 9 107,984,119 (GRCm39) missense unknown
R2507:Bsn UTSW 9 107,993,313 (GRCm39) missense probably damaging 1.00
R2880:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2881:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2922:Bsn UTSW 9 107,992,668 (GRCm39) missense probably damaging 1.00
R2922:Bsn UTSW 9 107,985,385 (GRCm39) missense unknown
R3618:Bsn UTSW 9 107,994,760 (GRCm39) critical splice acceptor site probably null
R3742:Bsn UTSW 9 107,982,938 (GRCm39) missense unknown
R3825:Bsn UTSW 9 107,984,055 (GRCm39) missense unknown
R3982:Bsn UTSW 9 107,984,365 (GRCm39) missense unknown
R4094:Bsn UTSW 9 107,991,069 (GRCm39) missense probably damaging 1.00
R4158:Bsn UTSW 9 107,990,145 (GRCm39) missense possibly damaging 0.95
R4225:Bsn UTSW 9 107,983,932 (GRCm39) missense unknown
R4261:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R4482:Bsn UTSW 9 107,991,863 (GRCm39) missense probably damaging 1.00
R4515:Bsn UTSW 9 107,981,277 (GRCm39) splice site probably null
R4585:Bsn UTSW 9 107,987,662 (GRCm39) unclassified probably benign
R4628:Bsn UTSW 9 107,990,434 (GRCm39) missense probably damaging 1.00
R4636:Bsn UTSW 9 107,992,623 (GRCm39) missense probably damaging 1.00
R4679:Bsn UTSW 9 107,987,329 (GRCm39) missense unknown
R4723:Bsn UTSW 9 107,989,854 (GRCm39) missense probably benign 0.03
R4843:Bsn UTSW 9 107,984,388 (GRCm39) missense unknown
R4885:Bsn UTSW 9 107,984,726 (GRCm39) nonsense probably null
R4936:Bsn UTSW 9 107,988,960 (GRCm39) missense probably damaging 1.00
R4942:Bsn UTSW 9 107,983,678 (GRCm39) missense unknown
R4972:Bsn UTSW 9 107,992,377 (GRCm39) missense probably damaging 1.00
R4992:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R5067:Bsn UTSW 9 107,989,152 (GRCm39) missense probably damaging 1.00
R5206:Bsn UTSW 9 107,982,572 (GRCm39) missense unknown
R5286:Bsn UTSW 9 107,988,123 (GRCm39) unclassified probably benign
R5492:Bsn UTSW 9 107,989,714 (GRCm39) missense probably damaging 0.98
R5553:Bsn UTSW 9 107,987,620 (GRCm39) unclassified probably benign
R5561:Bsn UTSW 9 107,982,710 (GRCm39) missense unknown
R5597:Bsn UTSW 9 107,992,131 (GRCm39) missense probably benign 0.06
R5646:Bsn UTSW 9 107,987,631 (GRCm39) unclassified probably benign
R5796:Bsn UTSW 9 108,003,223 (GRCm39) missense probably damaging 1.00
R5801:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5802:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5850:Bsn UTSW 9 107,992,149 (GRCm39) missense probably damaging 0.99
R5938:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R6221:Bsn UTSW 9 107,982,765 (GRCm39) missense unknown
R6243:Bsn UTSW 9 107,984,760 (GRCm39) missense unknown
R6254:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.96
R6263:Bsn UTSW 9 107,990,453 (GRCm39) missense probably damaging 1.00
R6345:Bsn UTSW 9 107,984,554 (GRCm39) missense unknown
R6368:Bsn UTSW 9 107,988,513 (GRCm39) unclassified probably benign
R6574:Bsn UTSW 9 107,991,153 (GRCm39) missense possibly damaging 0.95
R6793:Bsn UTSW 9 107,991,814 (GRCm39) nonsense probably null
R6802:Bsn UTSW 9 107,987,823 (GRCm39) unclassified probably benign
R6943:Bsn UTSW 9 107,985,016 (GRCm39) missense unknown
R6999:Bsn UTSW 9 107,990,632 (GRCm39) missense probably benign 0.00
R7149:Bsn UTSW 9 107,993,520 (GRCm39) nonsense probably null
R7199:Bsn UTSW 9 107,992,533 (GRCm39) missense probably damaging 1.00
R7322:Bsn UTSW 9 108,003,620 (GRCm39) nonsense probably null
R7349:Bsn UTSW 9 107,987,982 (GRCm39) missense unknown
R7372:Bsn UTSW 9 107,987,718 (GRCm39) missense unknown
R7373:Bsn UTSW 9 107,990,683 (GRCm39) missense probably damaging 1.00
R7413:Bsn UTSW 9 108,016,690 (GRCm39) missense possibly damaging 0.61
R7473:Bsn UTSW 9 107,989,449 (GRCm39) missense probably damaging 1.00
R7482:Bsn UTSW 9 107,990,728 (GRCm39) missense probably damaging 0.98
R7530:Bsn UTSW 9 107,989,155 (GRCm39) missense probably damaging 1.00
R7549:Bsn UTSW 9 107,992,014 (GRCm39) missense probably benign 0.05
R7570:Bsn UTSW 9 107,990,742 (GRCm39) missense probably damaging 1.00
R7635:Bsn UTSW 9 107,988,189 (GRCm39) missense unknown
R7696:Bsn UTSW 9 107,991,700 (GRCm39) missense probably damaging 1.00
R7757:Bsn UTSW 9 107,991,939 (GRCm39) missense possibly damaging 0.90
R7868:Bsn UTSW 9 107,992,098 (GRCm39) missense possibly damaging 0.95
R7897:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.98
R7960:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R8022:Bsn UTSW 9 107,991,603 (GRCm39) missense probably benign 0.01
R8056:Bsn UTSW 9 107,982,506 (GRCm39) missense
R8158:Bsn UTSW 9 107,987,232 (GRCm39) missense unknown
R8161:Bsn UTSW 9 108,016,729 (GRCm39) missense probably benign 0.20
R8225:Bsn UTSW 9 107,984,305 (GRCm39) missense
R8282:Bsn UTSW 9 107,984,890 (GRCm39) missense possibly damaging 0.73
R8296:Bsn UTSW 9 107,994,578 (GRCm39) missense probably benign 0.00
R8415:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8417:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8426:Bsn UTSW 9 108,003,772 (GRCm39) missense probably damaging 1.00
R8437:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8438:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8439:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8440:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8441:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8442:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8513:Bsn UTSW 9 107,991,709 (GRCm39) missense possibly damaging 0.65
R8529:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8535:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8546:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8548:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8549:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8682:Bsn UTSW 9 107,983,368 (GRCm39) missense
R8773:Bsn UTSW 9 107,987,704 (GRCm39) missense unknown
R8883:Bsn UTSW 9 107,990,227 (GRCm39) missense probably damaging 0.98
R8906:Bsn UTSW 9 107,984,752 (GRCm39) missense unknown
R9018:Bsn UTSW 9 107,994,488 (GRCm39) missense probably benign 0.06
R9070:Bsn UTSW 9 107,987,295 (GRCm39) missense
R9094:Bsn UTSW 9 107,988,052 (GRCm39) missense unknown
R9098:Bsn UTSW 9 107,990,173 (GRCm39) missense possibly damaging 0.65
R9128:Bsn UTSW 9 107,993,349 (GRCm39) missense probably benign 0.21
R9162:Bsn UTSW 9 107,987,883 (GRCm39) missense unknown
R9224:Bsn UTSW 9 107,982,686 (GRCm39) missense
R9230:Bsn UTSW 9 107,989,459 (GRCm39) missense probably damaging 1.00
R9233:Bsn UTSW 9 107,994,289 (GRCm39) missense probably benign 0.28
R9275:Bsn UTSW 9 107,988,819 (GRCm39) missense probably damaging 1.00
R9307:Bsn UTSW 9 107,992,993 (GRCm39) missense probably benign 0.01
R9343:Bsn UTSW 9 107,992,701 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,993,361 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,990,800 (GRCm39) missense probably damaging 1.00
R9378:Bsn UTSW 9 107,984,854 (GRCm39) missense possibly damaging 0.85
R9408:Bsn UTSW 9 108,016,652 (GRCm39) nonsense probably null
R9455:Bsn UTSW 9 107,988,531 (GRCm39) missense unknown
R9563:Bsn UTSW 9 107,984,616 (GRCm39) missense
R9615:Bsn UTSW 9 107,984,430 (GRCm39) missense
R9656:Bsn UTSW 9 107,994,407 (GRCm39) missense probably benign 0.09
R9698:Bsn UTSW 9 107,993,170 (GRCm39) missense probably damaging 1.00
X0028:Bsn UTSW 9 107,990,703 (GRCm39) missense probably damaging 1.00
X0066:Bsn UTSW 9 108,016,409 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 108,016,394 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 107,982,698 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTGTCGTCTTCCTCCAAGTTG -3'
(R):5'- CAAAGTGGGTAGTAGCTTGCG -3'

Sequencing Primer
(F):5'- AAGTTGTCTTCCTCGGCAC -3'
(R):5'- TGTAGCTCCCAGTGCGGAATG -3'
Posted On 2022-03-25