Incidental Mutation 'R0746:Yars'
ID70123
Institutional Source Beutler Lab
Gene Symbol Yars
Ensembl Gene ENSMUSG00000028811
Gene Nametyrosyl-tRNA synthetase
Synonyms
MMRRC Submission 038927-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0746 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129189760-129219607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129197286 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 162 (S162R)
Ref Sequence ENSEMBL: ENSMUSP00000101669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106054]
Predicted Effect probably damaging
Transcript: ENSMUST00000106054
AA Change: S162R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811
AA Change: S162R

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128287
Predicted Effect unknown
Transcript: ENSMUST00000133992
AA Change: S57R
SMART Domains Protein: ENSMUSP00000118512
Gene: ENSMUSG00000028811
AA Change: S57R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 75 2.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140708
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik T C 17: 79,628,286 probably benign Het
Acvr1 T C 2: 58,500,550 M1V probably null Het
Adamts10 T A 17: 33,549,547 C866* probably null Het
Adgrv1 G A 13: 81,570,556 P4S probably benign Het
Arhgef37 A G 18: 61,517,993 probably null Het
Arid4b A G 13: 14,143,038 T169A probably benign Het
Cabp7 A T 11: 4,738,900 I190N probably damaging Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Ces1d A G 8: 93,189,468 F177S probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Csmd2 T A 4: 128,414,297 C1283S probably damaging Het
Cul1 T C 6: 47,518,288 probably null Het
F7 T G 8: 13,034,740 S255R probably benign Het
Fanci T A 7: 79,439,681 I955N probably damaging Het
Focad C A 4: 88,397,214 D1536E possibly damaging Het
Fus A G 7: 127,985,424 probably benign Het
Gpr146 C T 5: 139,393,222 R260W probably damaging Het
Grid1 T C 14: 34,822,690 F73L possibly damaging Het
Ilf2 T A 3: 90,482,807 V142D probably damaging Het
Kcna2 A G 3: 107,105,168 D355G probably benign Het
Mgat4c T C 10: 102,388,687 F254S probably damaging Het
Mrps10 A C 17: 47,372,639 R139S probably benign Het
Myh2 A G 11: 67,173,431 T71A probably benign Het
Myo1d A C 11: 80,586,879 Y893D possibly damaging Het
Ncapd2 T C 6: 125,174,264 E760G possibly damaging Het
Olfr509 A T 7: 108,646,041 D178E probably damaging Het
Olfr745 T A 14: 50,642,775 probably null Het
Pkhd1 T A 1: 20,198,107 D3349V probably damaging Het
Ptprn2 A C 12: 116,901,017 M551L probably benign Het
Ptprq A G 10: 107,517,831 Y2275H probably damaging Het
Rfx7 A G 9: 72,619,106 T1193A probably benign Het
Rtl1 T C 12: 109,592,960 D815G probably damaging Het
Scn1a T A 2: 66,351,126 T18S probably benign Het
Sept5 T C 16: 18,623,225 H277R probably damaging Het
Sh3bp5l A G 11: 58,346,347 S377G probably benign Het
Snx2 T A 18: 53,197,889 I142K possibly damaging Het
Spata31d1a C A 13: 59,702,263 D684Y possibly damaging Het
Taar6 C A 10: 23,985,360 S96I probably benign Het
Thsd7b C A 1: 130,188,531 H1340Q probably benign Het
Tmem115 C T 9: 107,537,999 T329M probably benign Het
Tmem50b C T 16: 91,581,690 probably null Het
Uhrf1bp1l T A 10: 89,805,454 I829K probably benign Het
Wdr64 A T 1: 175,792,973 D316V possibly damaging Het
Other mutations in Yars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Yars APN 4 129206142 missense probably damaging 1.00
IGL02039:Yars APN 4 129215259 missense probably damaging 1.00
IGL03324:Yars APN 4 129210535 missense probably benign 0.01
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0646:Yars UTSW 4 129213939 unclassified probably benign
R0894:Yars UTSW 4 129197155 missense probably damaging 0.97
R2115:Yars UTSW 4 129207923 intron probably null
R2134:Yars UTSW 4 129197199 nonsense probably null
R2189:Yars UTSW 4 129206189 missense probably damaging 1.00
R4190:Yars UTSW 4 129200027 nonsense probably null
R4863:Yars UTSW 4 129189882 unclassified probably benign
R4915:Yars UTSW 4 129210591 unclassified probably benign
R5450:Yars UTSW 4 129197246 missense possibly damaging 0.94
R5631:Yars UTSW 4 129209749 missense probably damaging 1.00
R5789:Yars UTSW 4 129196897 missense probably damaging 1.00
R6384:Yars UTSW 4 129196978 critical splice donor site probably null
R6837:Yars UTSW 4 129209751 missense possibly damaging 0.77
R7713:Yars UTSW 4 129210498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCATACCTGGACAACATGAAAGCC -3'
(R):5'- CCACCACAGTAAGAACTGCTGGAAG -3'

Sequencing Primer
(F):5'- ATGAAAGCCCCCTGGGAG -3'
(R):5'- CCAAAAGTTATGCGCTTCAAGG -3'
Posted On2013-09-30