Incidental Mutation 'R9245:Golgb1'
ID 701259
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgi autoantigen, golgin subfamily b, macrogolgin 1
Synonyms Giantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock # R9245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36875140-36933085 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 36918819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 2548 (Q2548*)
Ref Sequence ENSEMBL: ENSMUSP00000045239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000039855
AA Change: Q2548*
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: Q2548*

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114812
AA Change: Q2507*
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: Q2507*

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,720 D3152G probably benign Het
Abhd15 C A 11: 77,515,486 H96Q possibly damaging Het
Ankhd1 A G 18: 36,655,600 Q411R Het
Ankrd34c A T 9: 89,728,887 V467E probably damaging Het
Apobr A T 7: 126,587,335 R673* probably null Het
Arhgap18 T C 10: 26,846,111 V98A possibly damaging Het
Arhgap30 G T 1: 171,408,389 W777L possibly damaging Het
Atp8a1 A G 5: 67,622,634 Y1154H unknown Het
B3gntl1 A G 11: 121,623,944 F299S possibly damaging Het
Baz2a C T 10: 128,121,943 T1055I probably benign Het
Baz2b T C 2: 59,912,987 M1547V probably benign Het
BC048403 A T 10: 121,750,368 H196L probably damaging Het
Bsn T C 9: 108,116,093 D820G probably damaging Het
Ccdc57 A G 11: 120,921,752 Y59H probably damaging Het
Crim1 T A 17: 78,344,442 C532S probably damaging Het
Csmd2 A C 4: 128,306,375 D451A Het
Cyp2d22 A T 15: 82,372,547 I342K probably damaging Het
Des A T 1: 75,366,762 T430S probably benign Het
Dnah17 C T 11: 118,125,677 V283I probably benign Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dst A G 1: 34,189,862 S2179G probably benign Het
Esrp2 T A 8: 106,132,143 T621S possibly damaging Het
Ext2 C T 2: 93,704,491 V643I probably benign Het
Fastk G A 5: 24,444,174 P72S probably benign Het
Fbxo28 A G 1: 182,318,001 I174T possibly damaging Het
Fstl3 C T 10: 79,778,577 L38F probably damaging Het
Gatsl3 T A 11: 4,220,485 N160K probably damaging Het
Gm960 T G 19: 4,696,040 K199Q possibly damaging Het
Gstm3 T C 3: 107,967,640 T99A probably benign Het
Hadh T C 3: 131,240,987 N220S probably damaging Het
Hist1h2bn A G 13: 21,754,199 D26G unknown Het
Hnrnpab T C 11: 51,606,413 T51A probably benign Het
Ikbkap C A 4: 56,771,003 R980L probably benign Het
Immt G T 6: 71,846,366 W67L probably benign Het
Ints8 T A 4: 11,213,811 probably null Het
Ipo7 T C 7: 110,044,619 V407A probably damaging Het
Kif20b T C 19: 34,938,325 S501P probably benign Het
Krt39 T G 11: 99,516,624 Q348P probably damaging Het
Lrp1b T A 2: 40,598,444 N4543I Het
Macrod2 T C 2: 141,810,614 V199A probably benign Het
Mast2 A G 4: 116,310,504 V1052A probably damaging Het
Mfap4 T C 11: 61,487,181 F149S probably damaging Het
Moap1 A G 12: 102,742,267 V341A unknown Het
Mprip G T 11: 59,737,577 E283D possibly damaging Het
Mrgpra2a A G 7: 47,427,256 F85L possibly damaging Het
Mx1 T A 16: 97,451,553 probably null Het
Ndc80 A T 17: 71,500,299 M554K probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr172 T A 16: 58,760,763 K138* probably null Het
Olfr592 A T 7: 103,186,987 I129F probably damaging Het
Olfr768 T A 10: 129,093,603 I124F probably damaging Het
Pck1 C T 2: 173,154,776 T161I probably damaging Het
Pclo T A 5: 14,676,945 M1939K unknown Het
Pcm1 T A 8: 41,279,840 N711K probably damaging Het
Pkd2l1 A G 19: 44,155,455 V393A probably benign Het
Pla2g15 G T 8: 106,162,907 A229S possibly damaging Het
Plekhg1 G A 10: 3,957,141 R741Q Het
Plod1 A G 4: 147,926,169 L275P possibly damaging Het
Plvap G T 8: 71,511,679 T13K possibly damaging Het
Plxna1 A T 6: 89,337,338 I707N probably damaging Het
Pnmal2 A G 7: 16,946,918 E609G probably benign Het
Ptger4 C T 15: 5,243,712 probably benign Het
Qars G T 9: 108,508,933 E108* probably null Het
Rfpl4 C A 7: 5,110,841 D114Y probably damaging Het
Rint1 A G 5: 23,805,413 T207A probably benign Het
Rxfp1 A G 3: 79,644,954 I680T probably benign Het
Skint2 A T 4: 112,645,419 K275N probably benign Het
Slc29a3 A G 10: 60,723,976 V133A possibly damaging Het
Slc9a2 A G 1: 40,766,300 K680E probably benign Het
Smc1b A T 15: 85,120,645 F409L probably benign Het
Sos2 A T 12: 69,648,465 M166K probably damaging Het
Tead1 A G 7: 112,759,516 I12V probably benign Het
Tead3 C A 17: 28,332,735 K461N probably benign Het
Tex12 C A 9: 50,557,472 A83S probably damaging Het
Ttc28 A G 5: 111,177,659 T319A unknown Het
Ttn T C 2: 76,898,249 I5496V unknown Het
Tubb4a T A 17: 57,080,959 I356F possibly damaging Het
Txk A T 5: 72,734,267 W119R probably damaging Het
Txnl4a A T 18: 80,218,722 I58F probably benign Het
Uba6 A T 5: 86,170,559 Y44N probably damaging Het
Usp40 T C 1: 87,950,287 T1093A probably benign Het
Vmn1r194 T C 13: 22,244,561 I116T probably benign Het
Vmn2r14 A G 5: 109,220,310 M272T possibly damaging Het
Vmn2r85 C A 10: 130,419,164 M550I possibly damaging Het
Vmn2r85 C A 10: 130,425,665 V268F probably damaging Het
Vwa5b2 T A 16: 20,598,140 V529E probably damaging Het
Zfp141 A T 7: 42,475,397 Y550* probably null Het
Zik1 G A 7: 10,490,229 L314F probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7830:Golgb1 UTSW 16 36898721 missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7944:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7945:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7950:Golgb1 UTSW 16 36915424 missense probably benign 0.13
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36918633 missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36916830 missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36912317 missense probably benign 0.00
R8684:Golgb1 UTSW 16 36914402 missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36916313 missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36919744 missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36915689 missense probably benign
R8825:Golgb1 UTSW 16 36919447 missense probably benign 0.00
R8940:Golgb1 UTSW 16 36916397 missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36913616 missense probably damaging 1.00
R9365:Golgb1 UTSW 16 36915762 missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36919605 missense probably benign 0.41
R9620:Golgb1 UTSW 16 36919449 missense probably benign
R9691:Golgb1 UTSW 16 36898634 missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36893407 missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCTCATCCAAGATGCTG -3'
(R):5'- TTCAGTTGGGCATGGTAGAC -3'

Sequencing Primer
(F):5'- ATCCAAGATGCTGCTGCTGAG -3'
(R):5'- ATGGTAGACACCTAGCGTTCC -3'
Posted On 2022-03-25