Incidental Mutation 'R9246:Dnah7c'
ID 701271
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R9246 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46532774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 802 (N802K)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000189749
AA Change: N802K

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: N802K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,580,536 T314I probably benign Het
4931409K22Rik T G 5: 24,548,971 E430A probably benign Het
Abca7 G A 10: 80,002,701 S603N probably damaging Het
Abcc2 T C 19: 43,798,443 F168L probably benign Het
Abcc8 T C 7: 46,124,865 T764A probably benign Het
Acot4 A C 12: 84,043,323 I265L probably benign Het
Adrb2 C A 18: 62,179,155 A200S probably damaging Het
Atp2c2 G T 8: 119,730,250 R197L probably damaging Het
Bmpr1a T C 14: 34,434,707 T121A probably benign Het
Brwd1 A T 16: 96,002,816 S2051R probably benign Het
Card10 T C 15: 78,788,836 E547G possibly damaging Het
Cbln1 A T 8: 87,470,420 I139N probably damaging Het
Ccdc86 CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA 19: 10,948,798 probably benign Het
Cdh16 C T 8: 104,617,970 D510N probably benign Het
Cdh2 G A 18: 16,648,597 Q146* probably null Het
Cdhr1 T G 14: 37,079,697 K763T possibly damaging Het
Cfl1 G C 19: 5,493,606 G204R probably damaging Het
Clcn6 A T 4: 148,029,409 V64E probably benign Het
Col4a4 G A 1: 82,453,235 P1649S unknown Het
Ctnna1 T A 18: 35,223,509 N410K probably benign Het
Dhx34 A G 7: 16,203,237 F845S probably damaging Het
Dnmt3a T C 12: 3,899,204 S492P probably damaging Het
Fhit C A 14: 10,421,494 probably null Het
Fzd2 A T 11: 102,605,923 I398F possibly damaging Het
Gm9195 A G 14: 72,472,874 S457P probably benign Het
Gnao1 A G 8: 93,950,339 K211E Het
Gzme T C 14: 56,118,741 D100G probably benign Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Hoxd4 G A 2: 74,728,403 C190Y possibly damaging Het
Hr T A 14: 70,571,475 V1097E probably damaging Het
Kdm3b A T 18: 34,808,427 K524* probably null Het
Kif18a A G 2: 109,333,474 T723A probably benign Het
Kif1a A G 1: 93,077,779 V91A probably damaging Het
Krtap19-2 AAAGCCTCCAAAGCCTCCATAGCCAGAGCCATATCCGAAGCCTCCA AAAGCCTCCA 16: 88,873,971 probably benign Het
Lama3 G A 18: 12,577,902 V1559M probably damaging Het
Msto1 A T 3: 88,912,104 I160N probably damaging Het
Muc5ac C A 7: 141,810,478 Q2509K probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1053 A T 2: 86,314,878 M136K probably damaging Het
Olfr51 T A 11: 51,007,064 F31I probably damaging Het
Olfr600 C T 7: 103,346,701 V76I probably damaging Het
Olfr701 C T 7: 106,818,731 T216I probably benign Het
Olfr862 T C 9: 19,884,390 probably benign Het
Pik3c3 C A 18: 30,333,311 A805D probably damaging Het
Pnn A G 12: 59,070,143 Q167R probably damaging Het
Pogk G T 1: 166,398,811 H590Q probably damaging Het
Prkcd A G 14: 30,605,475 L251P probably damaging Het
Prrc1 T A 18: 57,363,136 V53E probably benign Het
Ripor1 T C 8: 105,618,890 F856S unknown Het
Rnf31 G A 14: 55,596,241 A569T probably benign Het
Robo1 T A 16: 72,972,290 D532E probably benign Het
Sh2d6 T A 6: 72,520,611 K3* probably null Het
Slc22a27 T C 19: 7,896,844 T289A probably benign Het
Speg T C 1: 75,384,854 S171P probably damaging Het
Stag1 T A 9: 100,888,276 F622I probably benign Het
Stxbp1 T C 2: 32,789,574 D589G possibly damaging Het
Syne1 T C 10: 5,305,706 I2391M probably benign Het
Sytl2 A G 7: 90,358,176 M49V probably benign Het
Tmem185b T C 1: 119,526,638 V43A probably damaging Het
Tmem57 A G 4: 134,837,931 V47A possibly damaging Het
Trappc8 A T 18: 20,860,533 M499K possibly damaging Het
Vmn1r172 T A 7: 23,660,168 S159R possibly damaging Het
Vmn1r62 A G 7: 5,675,629 Y103C probably damaging Het
Vmn1r65 C T 7: 6,008,770 C155Y possibly damaging Het
Vmn2r112 G A 17: 22,605,107 V448I probably benign Het
Zfp592 A T 7: 81,041,781 D1236V probably benign Het
Zfp827 T C 8: 79,076,503 V568A possibly damaging Het
Zscan4-ps3 A T 7: 11,612,393 I147F probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACCCATCTTTTCAGATTGATCAG -3'
(R):5'- TCAGAGGGTAGCCAACGATG -3'

Sequencing Primer
(F):5'- TTGATCAGTTCAATGCAGAAGAG -3'
(R):5'- AACGATGGTGGACATGGCCTC -3'
Posted On 2022-03-25