Incidental Mutation 'R9246:Hook3'
ID 701300
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9246 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 26021421-26119224 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26072291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
AlphaFold Q8BUK6
Predicted Effect probably benign
Transcript: ENSMUST00000037182
AA Change: T249A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: T249A

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211292
Meta Mutation Damage Score 0.0655 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,580,536 T314I probably benign Het
4931409K22Rik T G 5: 24,548,971 E430A probably benign Het
Abca7 G A 10: 80,002,701 S603N probably damaging Het
Abcc2 T C 19: 43,798,443 F168L probably benign Het
Abcc8 T C 7: 46,124,865 T764A probably benign Het
Acot4 A C 12: 84,043,323 I265L probably benign Het
Adrb2 C A 18: 62,179,155 A200S probably damaging Het
Atp2c2 G T 8: 119,730,250 R197L probably damaging Het
Bmpr1a T C 14: 34,434,707 T121A probably benign Het
Brwd1 A T 16: 96,002,816 S2051R probably benign Het
Card10 T C 15: 78,788,836 E547G possibly damaging Het
Cbln1 A T 8: 87,470,420 I139N probably damaging Het
Ccdc86 CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA 19: 10,948,798 probably benign Het
Cdh16 C T 8: 104,617,970 D510N probably benign Het
Cdh2 G A 18: 16,648,597 Q146* probably null Het
Cdhr1 T G 14: 37,079,697 K763T possibly damaging Het
Cfl1 G C 19: 5,493,606 G204R probably damaging Het
Clcn6 A T 4: 148,029,409 V64E probably benign Het
Col4a4 G A 1: 82,453,235 P1649S unknown Het
Ctnna1 T A 18: 35,223,509 N410K probably benign Het
Dhx34 A G 7: 16,203,237 F845S probably damaging Het
Dnah7c T G 1: 46,532,774 N802K possibly damaging Het
Dnmt3a T C 12: 3,899,204 S492P probably damaging Het
Fhit C A 14: 10,421,494 probably null Het
Fzd2 A T 11: 102,605,923 I398F possibly damaging Het
Gm9195 A G 14: 72,472,874 S457P probably benign Het
Gnao1 A G 8: 93,950,339 K211E Het
Gzme T C 14: 56,118,741 D100G probably benign Het
Hoxd4 G A 2: 74,728,403 C190Y possibly damaging Het
Hr T A 14: 70,571,475 V1097E probably damaging Het
Kdm3b A T 18: 34,808,427 K524* probably null Het
Kif18a A G 2: 109,333,474 T723A probably benign Het
Kif1a A G 1: 93,077,779 V91A probably damaging Het
Krtap19-2 AAAGCCTCCAAAGCCTCCATAGCCAGAGCCATATCCGAAGCCTCCA AAAGCCTCCA 16: 88,873,971 probably benign Het
Lama3 G A 18: 12,577,902 V1559M probably damaging Het
Msto1 A T 3: 88,912,104 I160N probably damaging Het
Muc5ac C A 7: 141,810,478 Q2509K probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1053 A T 2: 86,314,878 M136K probably damaging Het
Olfr51 T A 11: 51,007,064 F31I probably damaging Het
Olfr600 C T 7: 103,346,701 V76I probably damaging Het
Olfr701 C T 7: 106,818,731 T216I probably benign Het
Olfr862 T C 9: 19,884,390 probably benign Het
Pik3c3 C A 18: 30,333,311 A805D probably damaging Het
Pnn A G 12: 59,070,143 Q167R probably damaging Het
Pogk G T 1: 166,398,811 H590Q probably damaging Het
Prkcd A G 14: 30,605,475 L251P probably damaging Het
Prrc1 T A 18: 57,363,136 V53E probably benign Het
Ripor1 T C 8: 105,618,890 F856S unknown Het
Rnf31 G A 14: 55,596,241 A569T probably benign Het
Robo1 T A 16: 72,972,290 D532E probably benign Het
Sh2d6 T A 6: 72,520,611 K3* probably null Het
Slc22a27 T C 19: 7,896,844 T289A probably benign Het
Speg T C 1: 75,384,854 S171P probably damaging Het
Stag1 T A 9: 100,888,276 F622I probably benign Het
Stxbp1 T C 2: 32,789,574 D589G possibly damaging Het
Syne1 T C 10: 5,305,706 I2391M probably benign Het
Sytl2 A G 7: 90,358,176 M49V probably benign Het
Tmem185b T C 1: 119,526,638 V43A probably damaging Het
Tmem57 A G 4: 134,837,931 V47A possibly damaging Het
Trappc8 A T 18: 20,860,533 M499K possibly damaging Het
Vmn1r172 T A 7: 23,660,168 S159R possibly damaging Het
Vmn1r62 A G 7: 5,675,629 Y103C probably damaging Het
Vmn1r65 C T 7: 6,008,770 C155Y possibly damaging Het
Vmn2r112 G A 17: 22,605,107 V448I probably benign Het
Zfp592 A T 7: 81,041,781 D1236V probably benign Het
Zfp827 T C 8: 79,076,503 V568A possibly damaging Het
Zscan4-ps3 A T 7: 11,612,393 I147F probably damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R7988:Hook3 UTSW 8 26073647 missense probably benign 0.02
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
R9121:Hook3 UTSW 8 26035167 missense probably damaging 1.00
R9223:Hook3 UTSW 8 26032524 missense
R9244:Hook3 UTSW 8 26071056 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAAGTCTATCTGTGTGCGTCAG -3'
(R):5'- CAAGAGTTTGAGTTGGATAACCAC -3'

Sequencing Primer
(F):5'- GCGTCAGAGTTAGCTAATATCTGC -3'
(R):5'- TGAGTTGGATAACCACAGTCC -3'
Posted On 2022-03-25