Incidental Mutation 'R0746:Tmem115'
ID70136
Institutional Source Beutler Lab
Gene Symbol Tmem115
Ensembl Gene ENSMUSG00000010045
Gene Nametransmembrane protein 115
SynonymsPl6
MMRRC Submission 038927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R0746 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107533945-107538673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107537999 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 329 (T329M)
Ref Sequence ENSEMBL: ENSMUSP00000010189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000010201] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235] [ENSMUST00000195370]
Predicted Effect probably benign
Transcript: ENSMUST00000010189
AA Change: T329M

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045
AA Change: T329M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000010201
SMART Domains Protein: ENSMUSP00000010201
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 5 279 1.7e-75 PFAM
Pfam:NPR2 269 373 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041459
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193628
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194906
Predicted Effect probably benign
Transcript: ENSMUST00000194967
Predicted Effect probably benign
Transcript: ENSMUST00000195235
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195370
SMART Domains Protein: ENSMUSP00000141746
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 2 156 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik T C 17: 79,628,286 probably benign Het
Acvr1 T C 2: 58,500,550 M1V probably null Het
Adamts10 T A 17: 33,549,547 C866* probably null Het
Adgrv1 G A 13: 81,570,556 P4S probably benign Het
Arhgef37 A G 18: 61,517,993 probably null Het
Arid4b A G 13: 14,143,038 T169A probably benign Het
Cabp7 A T 11: 4,738,900 I190N probably damaging Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Ces1d A G 8: 93,189,468 F177S probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Csmd2 T A 4: 128,414,297 C1283S probably damaging Het
Cul1 T C 6: 47,518,288 probably null Het
F7 T G 8: 13,034,740 S255R probably benign Het
Fanci T A 7: 79,439,681 I955N probably damaging Het
Focad C A 4: 88,397,214 D1536E possibly damaging Het
Fus A G 7: 127,985,424 probably benign Het
Gpr146 C T 5: 139,393,222 R260W probably damaging Het
Grid1 T C 14: 34,822,690 F73L possibly damaging Het
Ilf2 T A 3: 90,482,807 V142D probably damaging Het
Kcna2 A G 3: 107,105,168 D355G probably benign Het
Mgat4c T C 10: 102,388,687 F254S probably damaging Het
Mrps10 A C 17: 47,372,639 R139S probably benign Het
Myh2 A G 11: 67,173,431 T71A probably benign Het
Myo1d A C 11: 80,586,879 Y893D possibly damaging Het
Ncapd2 T C 6: 125,174,264 E760G possibly damaging Het
Olfr509 A T 7: 108,646,041 D178E probably damaging Het
Olfr745 T A 14: 50,642,775 probably null Het
Pkhd1 T A 1: 20,198,107 D3349V probably damaging Het
Ptprn2 A C 12: 116,901,017 M551L probably benign Het
Ptprq A G 10: 107,517,831 Y2275H probably damaging Het
Rfx7 A G 9: 72,619,106 T1193A probably benign Het
Rtl1 T C 12: 109,592,960 D815G probably damaging Het
Scn1a T A 2: 66,351,126 T18S probably benign Het
Sept5 T C 16: 18,623,225 H277R probably damaging Het
Sh3bp5l A G 11: 58,346,347 S377G probably benign Het
Snx2 T A 18: 53,197,889 I142K possibly damaging Het
Spata31d1a C A 13: 59,702,263 D684Y possibly damaging Het
Taar6 C A 10: 23,985,360 S96I probably benign Het
Thsd7b C A 1: 130,188,531 H1340Q probably benign Het
Tmem50b C T 16: 91,581,690 probably null Het
Uhrf1bp1l T A 10: 89,805,454 I829K probably benign Het
Wdr64 A T 1: 175,792,973 D316V possibly damaging Het
Yars C A 4: 129,197,286 S162R probably damaging Het
Other mutations in Tmem115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Tmem115 APN 9 107534582 missense probably damaging 1.00
IGL01142:Tmem115 APN 9 107534645 missense possibly damaging 0.94
IGL01386:Tmem115 APN 9 107534660 missense probably damaging 1.00
IGL01705:Tmem115 APN 9 107535204 missense probably benign 0.44
R1511:Tmem115 UTSW 9 107534975 missense probably benign 0.04
R4182:Tmem115 UTSW 9 107535283 missense probably damaging 1.00
R4770:Tmem115 UTSW 9 107534957 missense probably benign 0.43
R5097:Tmem115 UTSW 9 107534860 missense probably benign 0.03
R5141:Tmem115 UTSW 9 107537942 missense probably benign 0.01
R5687:Tmem115 UTSW 9 107534855 missense probably benign 0.17
R7145:Tmem115 UTSW 9 107535086 missense probably benign 0.30
R8299:Tmem115 UTSW 9 107534546 missense possibly damaging 0.94
R8353:Tmem115 UTSW 9 107534798 missense probably benign 0.44
R8453:Tmem115 UTSW 9 107534798 missense probably benign 0.44
X0067:Tmem115 UTSW 9 107534513 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGTGGGATTTGGAGGCAAACC -3'
(R):5'- TGTTGTCCAGACACAGCGGAAG -3'

Sequencing Primer
(F):5'- CAGAGTATGTTGGTCTCCCAAAC -3'
(R):5'- CGGAAGGCCACAGGAACC -3'
Posted On2013-09-30