Incidental Mutation 'R0746:Taar6'
ID70137
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Nametrace amine-associated receptor 6
SynonymsLOC215855
MMRRC Submission 038927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0746 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23984609-23985646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23985360 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 96 (S96I)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
Predicted Effect probably benign
Transcript: ENSMUST00000057080
AA Change: S96I

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: S96I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik T C 17: 79,628,286 probably benign Het
Acvr1 T C 2: 58,500,550 M1V probably null Het
Adamts10 T A 17: 33,549,547 C866* probably null Het
Adgrv1 G A 13: 81,570,556 P4S probably benign Het
Arhgef37 A G 18: 61,517,993 probably null Het
Arid4b A G 13: 14,143,038 T169A probably benign Het
Cabp7 A T 11: 4,738,900 I190N probably damaging Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Ces1d A G 8: 93,189,468 F177S probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Csmd2 T A 4: 128,414,297 C1283S probably damaging Het
Cul1 T C 6: 47,518,288 probably null Het
F7 T G 8: 13,034,740 S255R probably benign Het
Fanci T A 7: 79,439,681 I955N probably damaging Het
Focad C A 4: 88,397,214 D1536E possibly damaging Het
Fus A G 7: 127,985,424 probably benign Het
Gpr146 C T 5: 139,393,222 R260W probably damaging Het
Grid1 T C 14: 34,822,690 F73L possibly damaging Het
Ilf2 T A 3: 90,482,807 V142D probably damaging Het
Kcna2 A G 3: 107,105,168 D355G probably benign Het
Mgat4c T C 10: 102,388,687 F254S probably damaging Het
Mrps10 A C 17: 47,372,639 R139S probably benign Het
Myh2 A G 11: 67,173,431 T71A probably benign Het
Myo1d A C 11: 80,586,879 Y893D possibly damaging Het
Ncapd2 T C 6: 125,174,264 E760G possibly damaging Het
Olfr509 A T 7: 108,646,041 D178E probably damaging Het
Olfr745 T A 14: 50,642,775 probably null Het
Pkhd1 T A 1: 20,198,107 D3349V probably damaging Het
Ptprn2 A C 12: 116,901,017 M551L probably benign Het
Ptprq A G 10: 107,517,831 Y2275H probably damaging Het
Rfx7 A G 9: 72,619,106 T1193A probably benign Het
Rtl1 T C 12: 109,592,960 D815G probably damaging Het
Scn1a T A 2: 66,351,126 T18S probably benign Het
Sept5 T C 16: 18,623,225 H277R probably damaging Het
Sh3bp5l A G 11: 58,346,347 S377G probably benign Het
Snx2 T A 18: 53,197,889 I142K possibly damaging Het
Spata31d1a C A 13: 59,702,263 D684Y possibly damaging Het
Thsd7b C A 1: 130,188,531 H1340Q probably benign Het
Tmem115 C T 9: 107,537,999 T329M probably benign Het
Tmem50b C T 16: 91,581,690 probably null Het
Uhrf1bp1l T A 10: 89,805,454 I829K probably benign Het
Wdr64 A T 1: 175,792,973 D316V possibly damaging Het
Yars C A 4: 129,197,286 S162R probably damaging Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23985508 missense probably benign 0.15
IGL00918:Taar6 APN 10 23985582 missense probably damaging 1.00
IGL01060:Taar6 APN 10 23985072 missense probably benign
IGL02608:Taar6 APN 10 23985183 missense probably benign 0.01
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0360:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0364:Taar6 UTSW 10 23985148 missense probably benign 0.01
R1637:Taar6 UTSW 10 23985181 missense probably benign 0.12
R4893:Taar6 UTSW 10 23985400 missense probably benign
R4944:Taar6 UTSW 10 23984715 missense probably damaging 1.00
R4951:Taar6 UTSW 10 23985208 missense probably benign 0.09
R5173:Taar6 UTSW 10 23985352 missense probably damaging 1.00
R5181:Taar6 UTSW 10 23984785 missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23985270 missense probably damaging 1.00
R5988:Taar6 UTSW 10 23985256 missense probably damaging 0.98
R6327:Taar6 UTSW 10 23985279 missense probably damaging 1.00
R6493:Taar6 UTSW 10 23985123 missense probably benign 0.36
R7595:Taar6 UTSW 10 23985070 missense probably benign
R7802:Taar6 UTSW 10 23985253 missense probably benign 0.02
R8053:Taar6 UTSW 10 23985246 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CAGACACAGACACCGTGAACTTGG -3'
(R):5'- GCAGCTCTGCTATGAGAATGTGACC -3'

Sequencing Primer
(F):5'- CCGTGAACTTGGTGGGATAGAC -3'
(R):5'- GAGGGTCATCCTCTATGCAGTC -3'
Posted On2013-09-30