Incidental Mutation 'R9248:Fig4'
ID 701370
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene Name FIG4 phosphoinositide 5-phosphatase
Synonyms A530089I17Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585
Essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R9248 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 41188172-41303260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41277482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 108 (V108I)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
AlphaFold Q91WF7
Predicted Effect probably benign
Transcript: ENSMUST00000043814
AA Change: V108I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: V108I

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (55/55)
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,153,934 N132S probably benign Het
Agpat2 A G 2: 26,593,589 *279Q probably null Het
Akr1c19 C A 13: 4,242,975 D243E probably benign Het
Alg2 A G 4: 47,474,001 F96L probably benign Het
Apob C T 12: 8,015,231 Q4067* probably null Het
C1ra A T 6: 124,512,621 probably benign Het
C8a T C 4: 104,846,002 Y330C probably damaging Het
Ccdc185 A G 1: 182,748,656 V156A probably benign Het
Ces1g A G 8: 93,333,691 L100P possibly damaging Het
Cnbd1 T C 4: 18,862,113 N359S possibly damaging Het
Crybb2 C T 5: 113,063,228 A65T probably benign Het
Dcaf5 T C 12: 80,339,789 D521G probably benign Het
Dnmt1 A G 9: 20,922,112 F631L possibly damaging Het
Dok1 T A 6: 83,031,912 D263V possibly damaging Het
Ecel1 A G 1: 87,153,390 F293L probably benign Het
Ehmt1 A T 2: 24,848,065 L509Q possibly damaging Het
Fbln2 T A 6: 91,254,574 V551E possibly damaging Het
Gpa33 A G 1: 166,163,827 Y209C probably damaging Het
Heatr5a T C 12: 51,916,243 H52R Het
Heatr9 A T 11: 83,518,455 D157E possibly damaging Het
Jakmip2 A C 18: 43,552,177 M682R probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Layn A G 9: 51,057,460 S328P possibly damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mboat1 A G 13: 30,226,409 Y283C probably damaging Het
Mdga2 A G 12: 66,689,452 V334A possibly damaging Het
Mroh4 C T 15: 74,613,318 R515H possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nsrp1 G A 11: 77,046,210 R387W probably benign Het
Olfr483 T C 7: 108,104,049 S247P probably damaging Het
Olfr894 T C 9: 38,219,410 Y193H probably benign Het
Ostm1 T C 10: 42,698,214 V301A probably damaging Het
Pcdhb13 A T 18: 37,444,555 D662V probably damaging Het
Pfpl T A 19: 12,429,010 S208R probably damaging Het
Plin5 A T 17: 56,112,324 V366E probably damaging Het
Rmi1 A G 13: 58,409,085 I383V probably benign Het
Rnh1 T C 7: 141,160,801 T414A probably benign Het
Sash1 C A 10: 8,741,532 G537W probably damaging Het
Slc9c1 A G 16: 45,550,188 N264S probably benign Het
Speg A C 1: 75,421,776 T1956P probably damaging Het
St14 T C 9: 31,091,609 Y666C probably damaging Het
Stab2 T A 10: 86,891,617 H1448L probably damaging Het
Syne2 C T 12: 76,107,456 probably benign Het
Taf9 T A 13: 100,654,352 probably benign Het
Thumpd2 G A 17: 81,026,611 A516V possibly damaging Het
Tmem132e A G 11: 82,444,482 K797E probably damaging Het
Tpte A G 8: 22,351,473 T494A possibly damaging Het
Ttc41 T A 10: 86,731,249 L593Q probably benign Het
Uggt1 A C 1: 36,210,022 I279S possibly damaging Het
Uxs1 A G 1: 43,764,924 F277S probably damaging Het
Vat1 A T 11: 101,460,554 N320K possibly damaging Het
Wdr81 G T 11: 75,445,430 A592E Het
Zfp780b C T 7: 27,973,718 probably null Het
Zfp944 A T 17: 22,343,638 probably null Het
Zfp956 G T 6: 47,957,503 G136W possibly damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41230041 nonsense probably null
R0144:Fig4 UTSW 10 41258049 missense probably damaging 0.99
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4304:Fig4 UTSW 10 41256427 missense probably benign 0.01
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R4858:Fig4 UTSW 10 41233590 missense probably benign 0.00
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7452:Fig4 UTSW 10 41240637 missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
R8263:Fig4 UTSW 10 41267715 nonsense probably null
R8319:Fig4 UTSW 10 41263101 missense probably damaging 1.00
R8409:Fig4 UTSW 10 41265431 missense probably benign 0.01
R8435:Fig4 UTSW 10 41285674 missense probably benign
R8474:Fig4 UTSW 10 41232174 missense probably benign 0.30
R9086:Fig4 UTSW 10 41285403 missense possibly damaging 0.50
R9131:Fig4 UTSW 10 41265411 missense possibly damaging 0.95
R9401:Fig4 UTSW 10 41267737 missense probably benign
R9564:Fig4 UTSW 10 41285391 missense probably benign 0.20
R9627:Fig4 UTSW 10 41232182 missense probably benign 0.01
R9649:Fig4 UTSW 10 41267767 missense probably benign 0.00
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGCAGAAACTGGAATATTGATCC -3'
(R):5'- GACGGTTTTCCTTATACCGAATTG -3'

Sequencing Primer
(F):5'- CTGGAATATTGATCCAACATTCAATG -3'
(R):5'- TGCATGCGAGGCAAGTACTCTAC -3'
Posted On 2022-03-25